EMAIL THIS PAGE TO A FRIEND

ANAPC1

anaphase promoting complex subunit 1

Synonyms: APC1 MCPR TSG24
UniProtKB ID: Q9H1A4, Q2M3H8, Q9BSE6, Q9H8D0
Gene ID:
Human(64682) Summary: This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Mouse(17222) anaphase promoting complex subunit 1
Rat(311412) anaphase promoting complex subunit 1
Zebrafish(568795) anaphase promoting complex subunit 1
cow(535565) anaphase promoting complex subunit 1
Horse(100051869) anaphase promoting complex subunit 1
domestic cat(101084353) anaphase promoting complex subunit 1
dog(475750) anaphase promoting complex subunit 1
chicken(421228) anaphase promoting complex subunit 1
sheep(101117916) anaphase promoting complex subunit 1
Domestic Rabbit(100348299) anaphase promoting complex subunit 1
naked mole-rat(101720524) anaphase promoting complex subunit 1
domestic guinea pig(100725716) anaphase promoting complex subunit 1
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500357 Anti-APC1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502771 Anti-APC1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry pricing
SAB4502772 Anti-APC1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB2900404 Anti-MCPR antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504218 Anti-phospho-APC1 (pSer688) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022662 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029991 MISSION® esiRNA esiRNA targeting human ANAPC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022662 Rosetta Predictions human pricing
NM_001107771 Rosetta Predictions rat pricing
NM_008569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355930 predicted 5630
2 SASI_Hs01_00011952 predicted 2912
3 SASI_Hs01_00011953 predicted 1243
4 SASI_Hs01_00011954 predicted 2854
5 SASI_Hs02_00355931 predicted 1952
6 SASI_Hs01_00011956 predicted 5755
7 SASI_Hs01_00011957 predicted 3449
8 SASI_Hs02_00355932 predicted 5254
9 SASI_Hs01_00011958 predicted 424
10 SASI_Hs02_00355933 predicted 5769
11 SASI_Hs01_00011951 predicted 1489
12 SASI_Hs01_00011955 predicted 2564
13 SASI_Hs01_00011959 predicted 4175
14 SASI_Hs01_00011960 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107771 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232105 predicted 1015
2 SASI_Rn02_00232106 predicted 4424
3 SASI_Rn02_00232107 predicted 3703
4 SASI_Rn02_00232108 predicted 5820
5 SASI_Rn02_00232109 predicted 4575
6 SASI_Rn02_00232110 predicted 3298
7 SASI_Rn02_00232111 predicted 4175
8 SASI_Rn02_00232112 predicted 3644
9 SASI_Rn02_00232113 predicted 4307
10 SASI_Rn02_00232114 predicted 1952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314184 predicted 5394
2 SASI_Mm01_00114261 predicted 4175
3 SASI_Mm01_00114262 predicted 718
4 SASI_Mm01_00114263 predicted 5407
5 SASI_Mm01_00114264 predicted 739
6 SASI_Mm01_00114265 predicted 2593
7 SASI_Mm01_00114266 predicted 3300
8 SASI_Mm01_00114267 predicted 5819
9 SASI_Mm01_00114268 predicted 3863
10 SASI_Mm02_00314185 predicted 678
11 SASI_Mm01_00114269 predicted 3856
12 SASI_Mm01_00114270 predicted 5511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022662
VALIDATED
ANAPC1 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-4601s1c1
Sequence:CCGGCCGTGCTCAGAGGATTTGAATCTCGAGATTCAAATCCTCTGAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-724s1c1
Sequence:CCGGGCAAAGCTCATGTATTAACATCTCGAGATGTTAATACATGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-2871s1c1
Sequence:CCGGGCAGACTTGTAGTCTTGAGTACTCGAGTACTCAAGACTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-1609s1c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-5624s1c1
Sequence:CCGGCCTGCATACATAGCAATGGATCTCGAGATCCATTGCTATGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-870s1c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-6135s21c1
Sequence:CCGGGACCAAACATCAAAGCTAAAGCTCGAGCTTTAGCTTTGATGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-855s21c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022662.2-2054s21c1
Sequence:CCGGTCCATGGTTAGGATCACTATTCTCGAGAATAGTGATCCTAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-2239s21c1
Sequence:CCGGCATGAACATGATGGGTTATAACTCGAGTTATAACCCATCATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-1594s21c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022662
VALIDATED
ANAPC1 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-4601s1c1
Sequence:CCGGCCGTGCTCAGAGGATTTGAATCTCGAGATTCAAATCCTCTGAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-724s1c1
Sequence:CCGGGCAAAGCTCATGTATTAACATCTCGAGATGTTAATACATGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-2871s1c1
Sequence:CCGGGCAGACTTGTAGTCTTGAGTACTCGAGTACTCAAGACTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-1609s1c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-5624s1c1
Sequence:CCGGCCTGCATACATAGCAATGGATCTCGAGATCCATTGCTATGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-870s1c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-6135s21c1
Sequence:CCGGGACCAAACATCAAAGCTAAAGCTCGAGCTTTAGCTTTGATGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-855s21c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022662.2-2054s21c1
Sequence:CCGGTCCATGGTTAGGATCACTATTCTCGAGAATAGTGATCCTAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-2239s21c1
Sequence:CCGGCATGAACATGATGGGTTATAACTCGAGTTATAACCCATCATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-1594s21c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022662
VALIDATED
ANAPC1 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-4601s1c1
Sequence:CCGGCCGTGCTCAGAGGATTTGAATCTCGAGATTCAAATCCTCTGAGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-724s1c1
Sequence:CCGGGCAAAGCTCATGTATTAACATCTCGAGATGTTAATACATGAGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-2871s1c1
Sequence:CCGGGCAGACTTGTAGTCTTGAGTACTCGAGTACTCAAGACTACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-1609s1c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022662.1-5624s1c1
Sequence:CCGGCCTGCATACATAGCAATGGATCTCGAGATCCATTGCTATGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_022662.1-870s1c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330751    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-6135s21c1
Sequence:CCGGGACCAAACATCAAAGCTAAAGCTCGAGCTTTAGCTTTGATGTTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-855s21c1
Sequence:CCGGCCAGAGAACCTTTACCTACTACTCGAGTAGTAGGTAAAGGTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022662.2-2054s21c1
Sequence:CCGGTCCATGGTTAGGATCACTATTCTCGAGAATAGTGATCCTAACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-2239s21c1
Sequence:CCGGCATGAACATGATGGGTTATAACTCGAGTTATAACCCATCATGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022662.2-1594s21c1
Sequence:CCGGGCTCCAGTTACGCTGTGTAAACTCGAGTTTACACAGCGTAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008569
VALIDATED
ANAPC1 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-6178s1c1
Sequence:CCGGCCAATGGAACTCAGTTGCATACTCGAGTATGCAACTGAGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-4360s1c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-3586s1c1
Sequence:CCGGCCTCCACGAAACACAACTGTACTCGAGTACAGTTGTGTTTCGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-2401s1c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-955s1c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-970s21c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-755s21c1
Sequence:CCGGGCATAGACGGGAAGGATTATACTCGAGTATAATCCTTCCCGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-6115s21c1
Sequence:CCGGAGGGAAACCCACCCTAGAAATCTCGAGATTTCTAGGGTGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-4375s21c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-2416s21c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008569
VALIDATED
ANAPC1 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-6178s1c1
Sequence:CCGGCCAATGGAACTCAGTTGCATACTCGAGTATGCAACTGAGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-4360s1c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-3586s1c1
Sequence:CCGGCCTCCACGAAACACAACTGTACTCGAGTACAGTTGTGTTTCGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-2401s1c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-955s1c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-970s21c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-755s21c1
Sequence:CCGGGCATAGACGGGAAGGATTATACTCGAGTATAATCCTTCCCGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-6115s21c1
Sequence:CCGGAGGGAAACCCACCCTAGAAATCTCGAGATTTCTAGGGTGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-4375s21c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-2416s21c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008569
VALIDATED
ANAPC1 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-6178s1c1
Sequence:CCGGCCAATGGAACTCAGTTGCATACTCGAGTATGCAACTGAGTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-4360s1c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008569.1-3586s1c1
Sequence:CCGGCCTCCACGAAACACAACTGTACTCGAGTACAGTTGTGTTTCGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-2401s1c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008569.1-955s1c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-970s21c1
Sequence:CCGGCGGGTACAGTATGTTGTAGATCTCGAGATCTACAACATACTGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-755s21c1
Sequence:CCGGGCATAGACGGGAAGGATTATACTCGAGTATAATCCTTCCCGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-6115s21c1
Sequence:CCGGAGGGAAACCCACCCTAGAAATCTCGAGATTTCTAGGGTGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-4375s21c1
Sequence:CCGGGCGTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008569.2-2416s21c1
Sequence:CCGGCGCAATGTTGAGTCTCATCTTCTCGAGAAGATGAGACTCAACATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks