EMAIL THIS PAGE TO A FRIEND

ANAPC2

anaphase promoting complex subunit 2

55 Gene Product Result for
Synonyms: APC2 RP11-350O14.5
UniProtKB ID: Q9UJX6, Q5VSG1, Q96DG5, Q96GG4, Q9P2E1
Gene ID:
Human(29882) Summary: A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The product of this gene is a component of the complex and shares sequence similarity with a recently identified family of proteins called cullins, which may also be involved in ubiquitin-mediated degradation. [provided by RefSeq, Jul 2008]
Mouse(99152) anaphase promoting complex subunit 2
Rat(296558) anaphase promoting complex subunit 2
Zebrafish(100318335) anaphase promoting complex subunit 2
chicken(417258) anaphase promoting complex subunit 2
cow(100336564) anaphase promoting complex subunit 2
dog(491236) anaphase promoting complex subunit 2
domestic cat(101082786) anaphase promoting complex subunit 2
cow(100337474) anaphase promoting complex subunit 2
sheep(101108299) anaphase promoting complex subunit 2
domestic guinea pig(100730651) anaphase promoting complex subunit 2
naked mole-rat(101719594) anaphase promoting complex subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013366 Rosetta Predictions human pricing
NM_001100532 Rosetta Predictions rat pricing
NM_175300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140388 predicted 1258
2 SASI_Hs01_00140389 predicted 2325
3 SASI_Hs01_00140391 predicted 1137
4 SASI_Hs01_00140392 predicted 518
5 SASI_Hs01_00140393 predicted 1236
6 SASI_Hs01_00140394 predicted 1923
7 SASI_Hs02_00344701 predicted 335
8 SASI_Hs01_00140395 predicted 1374
9 SASI_Hs01_00140396 predicted 432
10 SASI_Hs02_00344702 predicted 1598
11 SASI_Hs01_00140387 predicted 601
12 SASI_Hs01_00140390 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209974 predicted 1353
2 SASI_Rn02_00209975 predicted 881
3 SASI_Rn02_00209976 predicted 1573
4 SASI_Rn02_00209977 predicted 1169
5 SASI_Rn02_00209978 predicted 1346
6 SASI_Rn02_00209979 predicted 2325
7 SASI_Rn02_00209980 predicted 1562
8 SASI_Rn02_00209981 predicted 2408
9 SASI_Rn02_00209982 predicted 1059
10 SASI_Rn02_00209983 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346052 predicted 1175
2 SASI_Mm01_00070583 predicted 1363
3 SASI_Mm01_00070584 predicted 1239
4 SASI_Mm01_00070585 predicted 312
5 SASI_Mm01_00070586 predicted 582
6 SASI_Mm01_00070587 predicted 2051
7 SASI_Mm01_00070589 predicted 2512
8 SASI_Mm01_00070590 predicted 2332
9 SASI_Mm01_00070592 predicted 915
10 SASI_Mm02_00346053 predicted 1244
11 SASI_Mm01_00070588 predicted 1368
12 SASI_Mm01_00070591 predicted 1919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013366
VALIDATED
ANAPC2 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2603s1c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2253s1c1
Sequence:CCGGGCTGCTCTTCTGGACGTACATCTCGAGATGTACGTCCAGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1194s1c1
Sequence:CCGGCCTCTATATCTCTGCCATCAACTCGAGTTGATGGCAGAGATATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013366.x-2128s1c1
Sequence:CCGGCCCGGCACCTTCTCTGTCATTCTCGAGAATGACAGAGAAGGTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1485s1c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2061s21c1
Sequence:CCGGAGGCGGTGATCTTGCTGTATTCTCGAGAATACAGCAAGATCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-608s21c1
Sequence:CCGGTGCTTCTTGAGAGTCTATATGCTCGAGCATATAGACTCTCAAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-543s21c1
Sequence:CCGGTGCGCGGAGTCTTGTTCTTTACTCGAGTAAAGAACAAGACTCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2676s21c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-1558s21c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013366
VALIDATED
ANAPC2 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2603s1c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2253s1c1
Sequence:CCGGGCTGCTCTTCTGGACGTACATCTCGAGATGTACGTCCAGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1194s1c1
Sequence:CCGGCCTCTATATCTCTGCCATCAACTCGAGTTGATGGCAGAGATATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013366.x-2128s1c1
Sequence:CCGGCCCGGCACCTTCTCTGTCATTCTCGAGAATGACAGAGAAGGTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1485s1c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2061s21c1
Sequence:CCGGAGGCGGTGATCTTGCTGTATTCTCGAGAATACAGCAAGATCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-608s21c1
Sequence:CCGGTGCTTCTTGAGAGTCTATATGCTCGAGCATATAGACTCTCAAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-543s21c1
Sequence:CCGGTGCGCGGAGTCTTGTTCTTTACTCGAGTAAAGAACAAGACTCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2676s21c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-1558s21c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013366
VALIDATED
ANAPC2 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2603s1c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-2253s1c1
Sequence:CCGGGCTGCTCTTCTGGACGTACATCTCGAGATGTACGTCCAGAAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1194s1c1
Sequence:CCGGCCTCTATATCTCTGCCATCAACTCGAGTTGATGGCAGAGATATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013366.x-2128s1c1
Sequence:CCGGCCCGGCACCTTCTCTGTCATTCTCGAGAATGACAGAGAAGGTGCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_013366.x-1485s1c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2061s21c1
Sequence:CCGGAGGCGGTGATCTTGCTGTATTCTCGAGAATACAGCAAGATCACCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-608s21c1
Sequence:CCGGTGCTTCTTGAGAGTCTATATGCTCGAGCATATAGACTCTCAAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-543s21c1
Sequence:CCGGTGCGCGGAGTCTTGTTCTTTACTCGAGTAAAGAACAAGACTCCGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-2676s21c1
Sequence:CCGGGCAGATTAAAGCAAGTCAGATCTCGAGATCTGACTTGCTTTAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013366.3-1558s21c1
Sequence:CCGGGCGGCGTTCATCGGACATCATCTCGAGATGATGTCCGATGAACGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175300
VALIDATED
ANAPC2 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1548s1c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175300.2-2697s1c1
Sequence:CCGGCCCATGAATACAAACAGGTTTCTCGAGAAACCTGTTTGTATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175300.2-73s1c1
Sequence:CCGGGCGACAATTATTGCCTCCGATCTCGAGATCGGAGGCAATAATTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1041s1c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-2329s1c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1547s21c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1040s21c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-304s21c1
Sequence:CCGGACGACCTTCAAGGCAATATTGCTCGAGCAATATTGCCTTGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2579s21c1
Sequence:CCGGCTAGATGGACAGCTTCTATTTCTCGAGAAATAGAAGCTGTCCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2328s21c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175300
VALIDATED
ANAPC2 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1548s1c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175300.2-2697s1c1
Sequence:CCGGCCCATGAATACAAACAGGTTTCTCGAGAAACCTGTTTGTATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175300.2-73s1c1
Sequence:CCGGGCGACAATTATTGCCTCCGATCTCGAGATCGGAGGCAATAATTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1041s1c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-2329s1c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1547s21c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1040s21c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-304s21c1
Sequence:CCGGACGACCTTCAAGGCAATATTGCTCGAGCAATATTGCCTTGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2579s21c1
Sequence:CCGGCTAGATGGACAGCTTCTATTTCTCGAGAAATAGAAGCTGTCCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2328s21c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175300
VALIDATED
ANAPC2 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1548s1c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175300.2-2697s1c1
Sequence:CCGGCCCATGAATACAAACAGGTTTCTCGAGAAACCTGTTTGTATTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175300.2-73s1c1
Sequence:CCGGGCGACAATTATTGCCTCCGATCTCGAGATCGGAGGCAATAATTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-1041s1c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175300.2-2329s1c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1547s21c1
Sequence:CCGGGCGACGTTCTTCAGACATCATCTCGAGATGATGTCTGAAGAACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-1040s21c1
Sequence:CCGGCCACGTACAGAGATTCTTCTACTCGAGTAGAAGAATCTCTGTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-304s21c1
Sequence:CCGGACGACCTTCAAGGCAATATTGCTCGAGCAATATTGCCTTGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2579s21c1
Sequence:CCGGCTAGATGGACAGCTTCTATTTCTCGAGAAATAGAAGCTGTCCATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175300.3-2328s21c1
Sequence:CCGGGCATACATCCAGGCCATGTTACTCGAGTAACATGGCCTGGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks