EMAIL THIS PAGE TO A FRIEND

ANAPC4

anaphase promoting complex subunit 4

61 Gene Product Result for
Synonyms: APC4
UniProtKB ID: Q9UJX5, A8K8H1, Q6PCC6, Q9NSH6
Gene ID:
Human(29945) Summary: A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. [provided by RefSeq, Jul 2008]
Mouse(52206) anaphase promoting complex subunit 4
Rat(305420) anaphase promoting complex subunit 4
naked mole-rat(101699443) anaphase promoting complex subunit 4
domestic guinea pig(100720696) anaphase promoting complex subunit 4
sheep(101105914) anaphase promoting complex subunit 4
Domestic Rabbit(100350229) anaphase promoting complex subunit 4
Zebrafish(494046) anaphase promoting complex subunit 4
chicken(422805) anaphase promoting complex subunit 4
dog(479123) anaphase promoting complex subunit 4
Horse(100067388) anaphase promoting complex subunit 4
cow(514572) anaphase promoting complex subunit 4
domestic cat(101080283) anaphase promoting complex subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013367 Rosetta Predictions human pricing
NM_001107220 Rosetta Predictions rat pricing
NM_024213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344703 predicted 683
2 SASI_Hs02_00344704 predicted 2013
3 SASI_Hs01_00076470 predicted 2201
4 SASI_Hs01_00076473 predicted 2105
5 SASI_Hs01_00076474 predicted 234
6 SASI_Hs01_00076475 predicted 792
7 SASI_Hs01_00076476 predicted 1388
8 SASI_Hs01_00076477 predicted 1335
9 SASI_Hs02_00344705 predicted 1091
10 SASI_Hs02_00344706 predicted 771
11 SASI_Hs01_00076469 predicted 2266
12 SASI_Hs01_00076471 predicted 1798
13 SASI_Hs01_00076472 predicted 1612
14 SASI_Hs01_00076478 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226695 predicted 1151
2 SASI_Rn02_00226696 predicted 1914
3 SASI_Rn02_00226697 predicted 2639
4 SASI_Rn02_00226698 predicted 1042
5 SASI_Rn02_00226699 predicted 1992
6 SASI_Rn02_00226700 predicted 812
7 SASI_Rn02_00226701 predicted 1385
8 SASI_Rn02_00226702 predicted 2223
9 SASI_Rn02_00226703 predicted 1343
10 SASI_Rn02_00226704 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029950 predicted 2012
2 SASI_Mm01_00029951 predicted 1319
3 SASI_Mm02_00327577 predicted 1279
4 SASI_Mm01_00029952 predicted 1865
5 SASI_Mm01_00029953 predicted 2151
6 SASI_Mm01_00029954 predicted 866
7 SASI_Mm01_00029955 predicted 1936
8 SASI_Mm01_00029956 predicted 1221
9 SASI_Mm01_00029957 predicted 1920
10 SASI_Mm01_00029958 predicted 1291
11 SASI_Mm01_00029959 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013367
VALIDATED
ANAPC4 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-883s21c1
Sequence:CCGGGCCAGAAAGTTTACTCATATTCTCGAGAATATGAGTAAACTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-2501s21c1
Sequence:CCGGTAGCTCCAGAGATAGTCATTACTCGAGTAATGACTATCTCTGGAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-604s1c1
Sequence:CCGGGCTGGTACTTGTCTTGCATTACTCGAGTAATGCAAGACAAGTACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2143s1c1
Sequence:CCGGGAAAGTATGAAAGCACAGTATCTCGAGATACTGTGCTTTCATACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-1151s1c1
Sequence:CCGGCAGGAATCGAAGAAGCTATAACTCGAGTTATAGCTTCTTCGATTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-558s1c1
Sequence:CCGGGCTTTATGCTTATGGAATGTTCTCGAGAACATTCCATAAGCATAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2072s1c1
Sequence:CCGGCAAGGCTAGATGAACAGTGTACTCGAGTACACTGTTCATCTAGCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013367
VALIDATED
ANAPC4 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-883s21c1
Sequence:CCGGGCCAGAAAGTTTACTCATATTCTCGAGAATATGAGTAAACTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-2501s21c1
Sequence:CCGGTAGCTCCAGAGATAGTCATTACTCGAGTAATGACTATCTCTGGAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-604s1c1
Sequence:CCGGGCTGGTACTTGTCTTGCATTACTCGAGTAATGCAAGACAAGTACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2143s1c1
Sequence:CCGGGAAAGTATGAAAGCACAGTATCTCGAGATACTGTGCTTTCATACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-1151s1c1
Sequence:CCGGCAGGAATCGAAGAAGCTATAACTCGAGTTATAGCTTCTTCGATTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-558s1c1
Sequence:CCGGGCTTTATGCTTATGGAATGTTCTCGAGAACATTCCATAAGCATAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2072s1c1
Sequence:CCGGCAAGGCTAGATGAACAGTGTACTCGAGTACACTGTTCATCTAGCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013367
VALIDATED
ANAPC4 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-883s21c1
Sequence:CCGGGCCAGAAAGTTTACTCATATTCTCGAGAATATGAGTAAACTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013367.2-2501s21c1
Sequence:CCGGTAGCTCCAGAGATAGTCATTACTCGAGTAATGACTATCTCTGGAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-604s1c1
Sequence:CCGGGCTGGTACTTGTCTTGCATTACTCGAGTAATGCAAGACAAGTACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2143s1c1
Sequence:CCGGGAAAGTATGAAAGCACAGTATCTCGAGATACTGTGCTTTCATACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-1151s1c1
Sequence:CCGGCAGGAATCGAAGAAGCTATAACTCGAGTTATAGCTTCTTCGATTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013367.x-558s1c1
Sequence:CCGGGCTTTATGCTTATGGAATGTTCTCGAGAACATTCCATAAGCATAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013367.x-2072s1c1
Sequence:CCGGCAAGGCTAGATGAACAGTGTACTCGAGTACACTGTTCATCTAGCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024213
VALIDATED
ANAPC4 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1964s21c1
Sequence:CCGGGTAATGGACTAATTGGTATTACTCGAGTAATACCAATTAGTCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1133s21c1
Sequence:CCGGAGTCTATAGAGTCATCATATTCTCGAGAATATGATGACTCTATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024213.2-2508s21c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-2158s21c1
Sequence:CCGGAGTGAAGATTCTGACGAATATCTCGAGATATTCGTCAGAATCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1816s21c1
Sequence:CCGGATGGACTGTGCACGAAGATTGCTCGAGCAATCTTCGTGCACAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1279s1c1
Sequence:CCGGGCAGGCATTGAAGATGCTATTCTCGAGAATAGCATCTTCAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1340s1c1
Sequence:CCGGTCCAAGTTATAGACAGTAGTACTCGAGTACTACTGTCTATAACTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024213.1-2508s1c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-671s1c1
Sequence:CCGGGCTCTGGATTTATTGAGCTTTCTCGAGAAAGCTCAATAAATCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024213
VALIDATED
ANAPC4 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1964s21c1
Sequence:CCGGGTAATGGACTAATTGGTATTACTCGAGTAATACCAATTAGTCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1133s21c1
Sequence:CCGGAGTCTATAGAGTCATCATATTCTCGAGAATATGATGACTCTATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024213.2-2508s21c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-2158s21c1
Sequence:CCGGAGTGAAGATTCTGACGAATATCTCGAGATATTCGTCAGAATCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1816s21c1
Sequence:CCGGATGGACTGTGCACGAAGATTGCTCGAGCAATCTTCGTGCACAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1279s1c1
Sequence:CCGGGCAGGCATTGAAGATGCTATTCTCGAGAATAGCATCTTCAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1340s1c1
Sequence:CCGGTCCAAGTTATAGACAGTAGTACTCGAGTACTACTGTCTATAACTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024213.1-2508s1c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-671s1c1
Sequence:CCGGGCTCTGGATTTATTGAGCTTTCTCGAGAAAGCTCAATAAATCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024213
VALIDATED
ANAPC4 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1964s21c1
Sequence:CCGGGTAATGGACTAATTGGTATTACTCGAGTAATACCAATTAGTCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1133s21c1
Sequence:CCGGAGTCTATAGAGTCATCATATTCTCGAGAATATGATGACTCTATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1931s21c1
Sequence:CCGGTAAGGAGACATACTGATATTTCTCGAGAAATATCAGTATGTCTCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024213.2-2508s21c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-2158s21c1
Sequence:CCGGAGTGAAGATTCTGACGAATATCTCGAGATATTCGTCAGAATCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024213.2-1816s21c1
Sequence:CCGGATGGACTGTGCACGAAGATTGCTCGAGCAATCTTCGTGCACAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1279s1c1
Sequence:CCGGGCAGGCATTGAAGATGCTATTCTCGAGAATAGCATCTTCAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-1340s1c1
Sequence:CCGGTCCAAGTTATAGACAGTAGTACTCGAGTACTACTGTCTATAACTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024213.1-2508s1c1
Sequence:CCGGCGTAGTCATCAAAGTGGAGAACTCGAGTTCTCCACTTTGATGACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024213.1-671s1c1
Sequence:CCGGGCTCTGGATTTATTGAGCTTTCTCGAGAAAGCTCAATAAATCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)