EMAIL THIS PAGE TO A FRIEND

ANAPC5

anaphase promoting complex subunit 5

61 Gene Product Result for
Synonyms: APC5
UniProtKB ID: Q9UJX4, E9PFB2, Q8N4H7, Q9BQD4
Gene ID:
Human(51433) Summary: This gene encodes a tetratricopeptide repeat-containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for the proper ubiquitination function of APC/C and for the interaction of APC/C with transcription coactivators. It also interacts with polyA binding protein and represses internal ribosome entry site-mediated translation. Multiple transcript variants encoding different isoforms have been found for this gene. These differences cause translation initiation at a downstream AUG and result in a shorter protein (isoform b), compared to isoform a. [provided by RefSeq, Nov 2008]
Mouse(59008) anaphase-promoting complex subunit 5
Rat(288671) anaphase-promoting complex subunit 5
Zebrafish(322854) anaphase promoting complex subunit 5
cow(540537) anaphase promoting complex subunit 5
Horse(100058548) anaphase promoting complex subunit 5
dog(477471) anaphase promoting complex subunit 5
chicken(416842) anaphase promoting complex subunit 5
sheep(101102840) anaphase promoting complex subunit 5
Domestic Rabbit(100350286) anaphase promoting complex subunit 5
domestic guinea pig(100726899) anaphase promoting complex subunit 5
naked mole-rat(101724399) anaphase promoting complex subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016237 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016237 Rosetta Predictions human pricing
NM_001080147 Rosetta Predictions rat pricing
NM_001042491 Rosetta Predictions mouse pricing
NM_021505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237086 predicted 949
2 SASI_Hs01_00237087 predicted 1969
3 SASI_Hs01_00237088 predicted 1651
4 SASI_Hs01_00237089 predicted 2136
5 SASI_Hs01_00237090 predicted 1111
6 SASI_Hs01_00237091 predicted 572
7 SASI_Hs01_00237092 predicted 1599
8 SASI_Hs01_00237093 predicted 338
9 SASI_Hs01_00237094 predicted 1075
10 SASI_Hs01_00237095 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208399 predicted 1281
2 SASI_Rn02_00208400 predicted 1642
3 SASI_Rn02_00208401 predicted 505
4 SASI_Rn02_00208402 predicted 775
5 SASI_Rn02_00208403 predicted 1938
6 SASI_Rn02_00208404 predicted 942
7 SASI_Rn02_00208405 predicted 1088
8 SASI_Rn02_00208406 predicted 2090
9 SASI_Rn02_00208407 predicted 1569
10 SASI_Rn02_00208408 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290445 predicted 432
2 SASI_Mm02_00290446 predicted 870
3 SASI_Mm02_00290447 predicted 582
4 SASI_Mm02_00290448 predicted 209
5 SASI_Mm02_00290449 predicted 805
6 SASI_Mm02_00290450 predicted 901
7 SASI_Mm02_00290451 predicted 1653
8 SASI_Mm02_00290452 predicted 838
9 SASI_Mm02_00290453 predicted 579
10 SASI_Mm02_00290454 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139713 predicted 438
2 SASI_Mm01_00139714 predicted 865
3 SASI_Mm01_00139715 predicted 585
4 SASI_Mm02_00326217 predicted 213
5 SASI_Mm01_00139716 predicted 801
6 SASI_Mm01_00139722 predicted 899
7 SASI_Mm02_00326218 predicted 1691
8 SASI_Mm01_00139717 predicted 843
9 SASI_Mm01_00139718 predicted 582
10 SASI_Mm01_00139719 predicted 857
11 SASI_Mm01_00139720 predicted 364
12 SASI_Mm01_00139721 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021505
VALIDATED
ANAPC5 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-2180s1c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-847s1c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-412s1c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-748s1c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-308s1c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-2233s21c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-466s21c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-802s21c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-362s21c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-901s21c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021505
VALIDATED
ANAPC5 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-2180s1c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-847s1c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-412s1c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-748s1c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-308s1c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-2233s21c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-466s21c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-802s21c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-362s21c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-901s21c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021505
VALIDATED
ANAPC5 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-2180s1c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-847s1c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-412s1c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-748s1c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021505.1-308s1c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-2233s21c1
Sequence:CCGGGCCAAGAACTACTTTGCACAACTCGAGTTGTGCAAAGTAGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-466s21c1
Sequence:CCGGCTGAAGGATATGGAACAATTTCTCGAGAAATTGTTCCATATCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-802s21c1
Sequence:CCGGGCCGCTTTGTTGAAGAATGATCTCGAGATCATTCTTCAACAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-362s21c1
Sequence:CCGGGCCCAGATATTACACTGTCAACTCGAGTTGACAGTGTAATATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021505.2-901s21c1
Sequence:CCGGGCTCATTACCTCAGCTACTTACTCGAGTAAGTAGCTGAGGTAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016237
VALIDATED
ANAPC5 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-2389s1c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-592s1c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-1436s1c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-725s1c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016237.x-1614s1c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1677s21c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-655s21c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1499s21c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-788s21c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016237.4-2452s21c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016237
VALIDATED
ANAPC5 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-2389s1c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-592s1c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-1436s1c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-725s1c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016237.x-1614s1c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1677s21c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-655s21c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1499s21c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-788s21c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016237.4-2452s21c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016237
VALIDATED
ANAPC5 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-2389s1c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-592s1c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-1436s1c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016237.x-725s1c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016237.x-1614s1c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1677s21c1
Sequence:CCGGGCAATGAATGATGGCAAATATCTCGAGATATTTGCCATCATTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-655s21c1
Sequence:CCGGCCAGTAGAGATGAGGGTGAAACTCGAGTTTCACCCTCATCTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-1499s21c1
Sequence:CCGGGCAGAACAACACAGAGTCCTTCTCGAGAAGGACTCTGTGTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016237.4-788s21c1
Sequence:CCGGGCTAAAGAATGATGAGACTAACTCGAGTTAGTCTCATCATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016237.4-2452s21c1
Sequence:CCGGTCTCTCCCTATAAATGATGTACTCGAGTACATCATTTATAGGGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks