EMAIL THIS PAGE TO A FRIEND

ANG

angiogenin, ribonuclease, RNase A family, 5

74 Gene Product Result for
Synonyms: ALS9 HEL168 RNASE4 RNASE5
UniProtKB ID: P03950, Q05CV1, Q53X86, Q6P5T2, Q8WXE7
Gene ID:
Human(283) Summary: The protein encoded by this gene is an exceedingly potent mediator of new blood vessel formation. It hydrolyzes cellular tRNAs resulting in decreased protein synthesis and is similar to pancreatic ribonuclease. Alternative splicing results in two transcript variants encoding the same protein. This gene and the gene that encodes ribonuclease, RNase A family, 4 share promoters and 5' exons. Each gene splices to a unique downstream exon that contains its complete coding region. [provided by RefSeq, Jul 2008]
Mouse(11727) angiogenin, ribonuclease, RNase A family, 5
Rat(497229) angiogenin, ribonuclease, RNase A family, 5
fruit fly(247753) angle wing
cow(100531624) Angularity
cow(100531620) Angularity
cow(100531890) Angularity
cow(100307881) Angularity
cow(100309081) Angularity
cow(100307880) Angularity
cow(100689537) Angularity
cow(100689571) Angularity
cow(100531603) Angularity
cow(100689583) Angularity
cow(100532719) Angularity
cow(100531478) Angularity
cow(777597) angiogenin, ribonuclease, RNase A family, 5
cow(100309080) Angularity
cow(100307882) Angularity
cow(100689535) Angularity
cow(100532530) Angularity
cow(100885230) Angularity
Horse(100034041) angiogenin, ribonuclease, RNase A family, 5
cow(100689536) Angularity
chicken(396194) angiogenin, ribonuclease, RNase A family, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022331 MISSION® esiRNA esiRNA targeting mouse Ang (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097577 Rosetta Predictions human pricing
NM_001145 Rosetta Predictions human pricing
NM_001012359 Rosetta Predictions rat pricing
NM_007447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318220 predicted 320
2 SASI_Hs02_00318221 predicted 304
3 SASI_Hs02_00318222 predicted 388
4 SASI_Hs02_00318223 predicted 420
5 SASI_Hs02_00318224 predicted 415
6 SASI_Hs02_00318225 predicted 489
7 SASI_Hs02_00318226 predicted 489
8 SASI_Hs02_00318227 predicted 419
9 SASI_Hs02_00318228 predicted 333
10 SASI_Hs02_00318229 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056466 predicted 792
2 SASI_Hs02_00331231 predicted 792
3 SASI_Hs01_00056469 predicted 874
4 SASI_Hs01_00056470 predicted 900
5 SASI_Hs02_00331232 predicted 898
6 SASI_Hs01_00056471 predicted 972
7 SASI_Hs02_00331233 predicted 970
8 SASI_Hs01_00056474 predicted 904
9 SASI_Hs02_00331234 predicted 814
10 SASI_Hs02_00331235 predicted 843
11 SASI_Hs01_00056465 predicted 297
12 SASI_Hs01_00056467 predicted 236
13 SASI_Hs01_00056468 predicted 276
14 SASI_Hs01_00056472 predicted 456
15 SASI_Hs01_00056473 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088528 predicted 228
2 SASI_Rn01_00088530 predicted 237
3 SASI_Rn01_00088533 predicted 230
4 SASI_Rn02_00200550 predicted 143
5 SASI_Rn01_00088529 predicted 200
6 SASI_Rn01_00088531 predicted 204
7 SASI_Rn01_00088532 predicted 286
8 SASI_Rn01_00088534 predicted 248
9 SASI_Rn01_00088535 predicted 245
10 SASI_Rn01_00088536 predicted 250
11 SASI_Rn01_00088537 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152709 predicted 449
2 SASI_Mm01_00152710 predicted 444
3 SASI_Mm01_00152711 predicted 322
4 SASI_Mm01_00152712 predicted 238
5 SASI_Mm01_00152713 predicted 434
6 SASI_Mm01_00152714 predicted 224
7 SASI_Mm01_00152715 predicted 430
8 SASI_Mm01_00152716 predicted 287
9 SASI_Mm01_00152717 predicted 436
10 SASI_Mm01_00152718 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007447
ANG MISSION shRNA Bacterial Glycerol Stock
angiogenin, ribonuclease, RNase A family, 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-217s1c1
Sequence:CCGGCGACAGATACTGTGAACGTATCTCGAGATACGTTCACAGTATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-440s1c1
Sequence:CCGGGCAGGGTTCAGACATGTTGTTCTCGAGAACAACATGTCTGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-483s1c1
Sequence:CCGGCGGTCCACTTCGATGAGTCATCTCGAGATGACTCATCGAAGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-237s1c1
Sequence:CCGGTGATGAAGAGAAGAAGCCTAACTCGAGTTAGGCTTCTTCTCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-292s1c1
Sequence:CCGGTGGCAACAAGAGCAACATCAACTCGAGTTGATGTTGCTCTTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007447
ANG MISSION shRNA shRNA Plasmid DNA
angiogenin, ribonuclease, RNase A family, 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-217s1c1
Sequence:CCGGCGACAGATACTGTGAACGTATCTCGAGATACGTTCACAGTATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-440s1c1
Sequence:CCGGGCAGGGTTCAGACATGTTGTTCTCGAGAACAACATGTCTGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-483s1c1
Sequence:CCGGCGGTCCACTTCGATGAGTCATCTCGAGATGACTCATCGAAGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-237s1c1
Sequence:CCGGTGATGAAGAGAAGAAGCCTAACTCGAGTTAGGCTTCTTCTCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-292s1c1
Sequence:CCGGTGGCAACAAGAGCAACATCAACTCGAGTTGATGTTGCTCTTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007447
ANG MISSION shRNA Lentiviral Transduction Particles
angiogenin, ribonuclease, RNase A family, 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-217s1c1
Sequence:CCGGCGACAGATACTGTGAACGTATCTCGAGATACGTTCACAGTATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-440s1c1
Sequence:CCGGGCAGGGTTCAGACATGTTGTTCTCGAGAACAACATGTCTGAACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-483s1c1
Sequence:CCGGCGGTCCACTTCGATGAGTCATCTCGAGATGACTCATCGAAGTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-237s1c1
Sequence:CCGGTGATGAAGAGAAGAAGCCTAACTCGAGTTAGGCTTCTTCTCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007447.2-292s1c1
Sequence:CCGGTGGCAACAAGAGCAACATCAACTCGAGTTGATGTTGCTCTTGTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145
VALIDATED
ANG MISSION shRNA Bacterial Glycerol Stock
angiogenin, ribonuclease, RNase A family, 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-641s1c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-544s1c1
Sequence:CCGGACGTTGTTGTTGCTTGTGAAACTCGAGTTTCACAAGCAACAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-576s1c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-300s1c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001145.2-365s1c1
Sequence:CCGGCAACACATTTATTCATGGCAACTCGAGTTGCCATGAATAAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-880s21c1
Sequence:CCGGAGAATAAGCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-674s21c1
Sequence:CCGGAGGATAACTCCAGGTACACACCTCGAGGTGTGTACCTGGAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1009s21c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1074s21c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-733s21c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145
VALIDATED
ANG MISSION shRNA shRNA Plasmid DNA
angiogenin, ribonuclease, RNase A family, 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-641s1c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-544s1c1
Sequence:CCGGACGTTGTTGTTGCTTGTGAAACTCGAGTTTCACAAGCAACAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-576s1c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-300s1c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001145.2-365s1c1
Sequence:CCGGCAACACATTTATTCATGGCAACTCGAGTTGCCATGAATAAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-880s21c1
Sequence:CCGGAGAATAAGCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-674s21c1
Sequence:CCGGAGGATAACTCCAGGTACACACCTCGAGGTGTGTACCTGGAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1009s21c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1074s21c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-733s21c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145
VALIDATED
ANG MISSION shRNA Lentiviral Transduction Particles
angiogenin, ribonuclease, RNase A family, 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-641s1c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-544s1c1
Sequence:CCGGACGTTGTTGTTGCTTGTGAAACTCGAGTTTCACAAGCAACAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-576s1c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001145.2-300s1c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001145.2-365s1c1
Sequence:CCGGCAACACATTTATTCATGGCAACTCGAGTTGCCATGAATAAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-880s21c1
Sequence:CCGGAGAATAAGCAAGTCTTCTTTCCTCGAGGAAAGAAGACTTGCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-674s21c1
Sequence:CCGGAGGATAACTCCAGGTACACACCTCGAGGTGTGTACCTGGAGTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1009s21c1
Sequence:CCGGGTCCACTTGGATCAGTCAATTCTCGAGAATTGACTGATCCAAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-1074s21c1
Sequence:CCGGTGCTGTCCTTGCCTTCCATTTCTCGAGAAATGGAAGGCAAGGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001145.4-733s21c1
Sequence:CCGGCGGGATGACAGATACTGTGAACTCGAGTTCACAGTATCTGTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks