EMAIL THIS PAGE TO A FRIEND

ANGEL1

angel homolog 1 (Drosophila)

114 Gene Product Result for
Synonyms: KIAA0759
UniProtKB ID: Q9UNK9, B4DWL7, O94859, Q8NCS9
Gene ID:
Mouse(68737) angel homolog 1 (Drosophila)
Rat(362765) angel homolog 1 (Drosophila)
chicken(423370) angel homolog 1 (Drosophila)
dog(490800) angel homolog 1 (Drosophila)
Horse(100058855) angel homolog 1 (Drosophila)
cow(508197) angel homolog 1 (Drosophila)
domestic cat(101084546) angel homolog 1 (Drosophila)
naked mole-rat(101709904) angel homolog 1 (Drosophila)
domestic guinea pig(100716556) angel homolog 1 (Drosophila)
sheep(101109279) angel homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015305 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015305 Rosetta Predictions human pricing
NM_001108717 Rosetta Predictions rat pricing
NM_144524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200957 predicted 783
2 SASI_Hs01_00200958 predicted 1514
3 SASI_Hs01_00200959 predicted 862
4 SASI_Hs01_00200961 predicted 1583
5 SASI_Hs01_00200962 predicted 1370
6 SASI_Hs01_00200963 predicted 1130
7 SASI_Hs01_00200964 predicted 1848
8 SASI_Hs01_00200965 predicted 1568
9 SASI_Hs01_00200966 predicted 1223
10 SASI_Hs02_00347523 predicted 993
11 SASI_Hs01_00200960 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241385 predicted 1577
2 SASI_Rn02_00241386 predicted 1844
3 SASI_Rn02_00241387 predicted 1835
4 SASI_Rn02_00241388 predicted 768
5 SASI_Rn02_00241389 predicted 919
6 SASI_Rn02_00241390 predicted 259
7 SASI_Rn02_00241391 predicted 870
8 SASI_Rn02_00241392 predicted 1549
9 SASI_Rn02_00241393 predicted 1245
10 SASI_Rn02_00241394 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116982 predicted 927
2 SASI_Mm02_00340043 predicted 1697
3 SASI_Mm01_00116983 predicted 1217
4 SASI_Mm01_00116984 predicted 522
5 SASI_Mm01_00116985 predicted 1844
6 SASI_Mm01_00116986 predicted 253
7 SASI_Mm01_00116987 predicted 1880
8 SASI_Mm01_00116988 predicted 1548
9 SASI_Mm01_00116989 predicted 794
10 SASI_Mm02_00340044 predicted 779
11 SASI_Mm01_00116980 predicted 793
12 SASI_Mm01_00116981 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144524
VALIDATED
ANGEL1 MISSION shRNA Bacterial Glycerol Stock
angel homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144524.2-716s21c1
Sequence:CCGGTGGCGAGAATGGGAGGATTTCCTCGAGGAAATCCTCCCATTCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144524.2-2365s21c1
Sequence:CCGGTATTCGCTTTCAGGCCATTTCCTCGAGGAAATGGCCTGAAAGCGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-2355s1c1
Sequence:CCGGGCGGGAGTTATTGATCTCATTCTCGAGAATGAGATCAATAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1902s1c1
Sequence:CCGGCCTGTGAGAATGAGAACAGAACTCGAGTTCTGTTCTCATTCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144524.1-701s1c1
Sequence:CCGGCCAATGGAAATACCTTATCATCTCGAGATGATAAGGTATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1597s1c1
Sequence:CCGGCCGAGACTTCCTACTACGATTCTCGAGAATCGTAGTAGGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1709s1c1
Sequence:CCGGGCCGAGTGTATCTTTGAGGAACTCGAGTTCCTCAAAGATACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144524
VALIDATED
ANGEL1 MISSION shRNA shRNA Plasmid DNA
angel homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144524.2-716s21c1
Sequence:CCGGTGGCGAGAATGGGAGGATTTCCTCGAGGAAATCCTCCCATTCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144524.2-2365s21c1
Sequence:CCGGTATTCGCTTTCAGGCCATTTCCTCGAGGAAATGGCCTGAAAGCGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-2355s1c1
Sequence:CCGGGCGGGAGTTATTGATCTCATTCTCGAGAATGAGATCAATAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1902s1c1
Sequence:CCGGCCTGTGAGAATGAGAACAGAACTCGAGTTCTGTTCTCATTCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144524.1-701s1c1
Sequence:CCGGCCAATGGAAATACCTTATCATCTCGAGATGATAAGGTATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1597s1c1
Sequence:CCGGCCGAGACTTCCTACTACGATTCTCGAGAATCGTAGTAGGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1709s1c1
Sequence:CCGGGCCGAGTGTATCTTTGAGGAACTCGAGTTCCTCAAAGATACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144524
VALIDATED
ANGEL1 MISSION shRNA Lentiviral Transduction Particles
angel homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144524.2-716s21c1
Sequence:CCGGTGGCGAGAATGGGAGGATTTCCTCGAGGAAATCCTCCCATTCTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144524.2-2365s21c1
Sequence:CCGGTATTCGCTTTCAGGCCATTTCCTCGAGGAAATGGCCTGAAAGCGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-2355s1c1
Sequence:CCGGGCGGGAGTTATTGATCTCATTCTCGAGAATGAGATCAATAACTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1902s1c1
Sequence:CCGGCCTGTGAGAATGAGAACAGAACTCGAGTTCTGTTCTCATTCTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144524.1-701s1c1
Sequence:CCGGCCAATGGAAATACCTTATCATCTCGAGATGATAAGGTATTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1597s1c1
Sequence:CCGGCCGAGACTTCCTACTACGATTCTCGAGAATCGTAGTAGGAAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144524.1-1709s1c1
Sequence:CCGGGCCGAGTGTATCTTTGAGGAACTCGAGTTCCTCAAAGATACACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015305
VALIDATED
ANGEL1 MISSION shRNA Bacterial Glycerol Stock
angel homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015305.2-2835s21c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-789s21c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1823s21c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1518s21c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1129s21c1
Sequence:CCGGGAGCTACTTAATCGGGATAATCTCGAGATTATCCCGATTAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-2835s1c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1823s1c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-3692s1c1
Sequence:CCGGCCTAGGTTCTAGGGAATTTATCTCGAGATAAATTCCCTAGAACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015305.2-1357s1c1
Sequence:CCGGGACCTAAATTCTGTCCCTGATCTCGAGATCAGGGACAGAATTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-789s1c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1518s1c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015305
VALIDATED
ANGEL1 MISSION shRNA shRNA Plasmid DNA
angel homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015305.2-2835s21c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-789s21c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1823s21c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1518s21c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1129s21c1
Sequence:CCGGGAGCTACTTAATCGGGATAATCTCGAGATTATCCCGATTAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-2835s1c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1823s1c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-3692s1c1
Sequence:CCGGCCTAGGTTCTAGGGAATTTATCTCGAGATAAATTCCCTAGAACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015305.2-1357s1c1
Sequence:CCGGGACCTAAATTCTGTCCCTGATCTCGAGATCAGGGACAGAATTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-789s1c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1518s1c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015305
VALIDATED
ANGEL1 MISSION shRNA Lentiviral Transduction Particles
angel homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015305.2-2835s21c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-789s21c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1823s21c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1518s21c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015305.2-1129s21c1
Sequence:CCGGGAGCTACTTAATCGGGATAATCTCGAGATTATCCCGATTAAGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-2835s1c1
Sequence:CCGGCCCACAGACCTGGTGTAATTTCTCGAGAAATTACACCAGGTCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1823s1c1
Sequence:CCGGCAGAGGTCACTACAATGCCATCTCGAGATGGCATTGTAGTGACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-3692s1c1
Sequence:CCGGCCTAGGTTCTAGGGAATTTATCTCGAGATAAATTCCCTAGAACCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015305.2-1357s1c1
Sequence:CCGGGACCTAAATTCTGTCCCTGATCTCGAGATCAGGGACAGAATTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-789s1c1
Sequence:CCGGCCAGTTCACTCTGATGTCTTACTCGAGTAAGACATCAGAGTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015305.2-1518s1c1
Sequence:CCGGCATCACTGATTGCTGTCAGTACTCGAGTACTGACAGCAATCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks