EMAIL THIS PAGE TO A FRIEND

ANGPT1

angiopoietin 1

134 Gene Product Result for
Synonyms: AGP1 AGPT ANG1
UniProtKB ID: Q15389, Q5HYA0
Gene ID:
Human(284) Summary: Angiopoietins are proteins with important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]
Mouse(11600) angiopoietin 1
Rat(89807) angiopoietin 1
naked mole-rat(101725800) angiopoietin 1
sheep(497271) angiopoietin 1
Zebrafish(114407) angiopoietin 1
chicken(395129) angiopoietin 1
Horse(100056482) angiopoietin 1
cow(282140) angiopoietin 1
domestic cat(101087130) angiopoietin 1
dog(403656) angiopoietin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001146 Rosetta Predictions human pricing
NM_053546 Rosetta Predictions rat pricing
NM_009640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067495 predicted 579
2 SASI_Hs02_00331236 predicted 1133
3 SASI_Hs01_00067496 predicted 1580
4 SASI_Hs01_00067497 predicted 1736
5 SASI_Hs01_00067498 predicted 913
6 SASI_Hs01_00067499 predicted 1933
7 SASI_Hs01_00067500 predicted 1632
8 SASI_Hs02_00331237 predicted 1916
9 SASI_Hs01_00067501 predicted 1618
10 SASI_Hs01_00067502 predicted 1513
11 SASI_Hs01_00067503 predicted 1440
12 SASI_Hs01_00067504 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046905 predicted 1659
2 SASI_Rn01_00046906 predicted 1175
3 SASI_Rn01_00046907 predicted 383
4 SASI_Rn01_00046908 predicted 1068
5 SASI_Rn01_00046909 predicted 1595
6 SASI_Rn01_00046911 predicted 1010
7 SASI_Rn02_00266177 predicted 516
8 SASI_Rn01_00046912 predicted 1452
9 SASI_Rn02_00266178 predicted 993
10 SASI_Rn01_00046913 predicted 1486
11 SASI_Rn01_00046904 predicted 1451
12 SASI_Rn01_00046910 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197784 predicted 450
2 SASI_Mm01_00197785 predicted 1033
3 SASI_Mm01_00197786 predicted 1711
4 SASI_Mm01_00197787 predicted 1644
5 SASI_Mm01_00197788 predicted 715
6 SASI_Mm01_00197789 predicted 1528
7 SASI_Mm02_00316607 predicted 560
8 SASI_Mm01_00197790 predicted 1483
9 SASI_Mm01_00197791 predicted 804
10 SASI_Mm01_00197792 predicted 1586
11 SASI_Mm01_00197793 predicted 1748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146
ANGPT1 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146.3-1512s21c1
Sequence:CCGGTGGAAATCCCTCCGGTGAATACTCGAGTATTCACCGGAGGGATTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146.3-2071s21c1
Sequence:CCGGCCAGCAATAAGTGGTAGTTATCTCGAGATAACTACCACTTATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-917s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACTTCTCGAGAAGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1130s1c1
Sequence:CCGGGCTTGGTTACTCGTCAAACATCTCGAGATGTTTGACGAGTAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1787s1c1
Sequence:CCGGCCCTCATGTTAACAGGAGGATCTCGAGATCCTCCTGTTAACATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1248s1c1
Sequence:CCGGCCTTGTCAATCTTTGCACTAACTCGAGTTAGTGCAAAGATTGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1927s1c1
Sequence:CCGGCGTTCCACAACTATGATGATTCTCGAGAATCATCATAGTTGTGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146
ANGPT1 MISSION shRNA shRNA Plasmid DNA
angiopoietin 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146.3-1512s21c1
Sequence:CCGGTGGAAATCCCTCCGGTGAATACTCGAGTATTCACCGGAGGGATTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146.3-2071s21c1
Sequence:CCGGCCAGCAATAAGTGGTAGTTATCTCGAGATAACTACCACTTATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-917s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACTTCTCGAGAAGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1130s1c1
Sequence:CCGGGCTTGGTTACTCGTCAAACATCTCGAGATGTTTGACGAGTAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1787s1c1
Sequence:CCGGCCCTCATGTTAACAGGAGGATCTCGAGATCCTCCTGTTAACATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1248s1c1
Sequence:CCGGCCTTGTCAATCTTTGCACTAACTCGAGTTAGTGCAAAGATTGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1927s1c1
Sequence:CCGGCGTTCCACAACTATGATGATTCTCGAGAATCATCATAGTTGTGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146
ANGPT1 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146.3-1512s21c1
Sequence:CCGGTGGAAATCCCTCCGGTGAATACTCGAGTATTCACCGGAGGGATTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146.3-2071s21c1
Sequence:CCGGCCAGCAATAAGTGGTAGTTATCTCGAGATAACTACCACTTATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-917s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACTTCTCGAGAAGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1130s1c1
Sequence:CCGGGCTTGGTTACTCGTCAAACATCTCGAGATGTTTGACGAGTAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1787s1c1
Sequence:CCGGCCCTCATGTTAACAGGAGGATCTCGAGATCCTCCTGTTAACATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1248s1c1
Sequence:CCGGCCTTGTCAATCTTTGCACTAACTCGAGTTAGTGCAAAGATTGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001146.3-1927s1c1
Sequence:CCGGCGTTCCACAACTATGATGATTCTCGAGAATCATCATAGTTGTGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009640
ANGPT1 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-783s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACATCTCGAGATGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1194s1c1
Sequence:CCGGCGGATGTATATCAAGCTGGTTCTCGAGAACCAGCTTGATATACATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-365s1c1
Sequence:CCGGGCTGCCATTCTGACTCACATACTCGAGTATGTGAGTCAGAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-996s1c1
Sequence:CCGGGCTTGGTTTCTCGTCAGACATCTCGAGATGTCTGACGAGAAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1693s1c1
Sequence:CCGGCCCTTCCAATCTAAATGGAATCTCGAGATTCCATTTAGATTGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009640
ANGPT1 MISSION shRNA shRNA Plasmid DNA
angiopoietin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-783s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACATCTCGAGATGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1194s1c1
Sequence:CCGGCGGATGTATATCAAGCTGGTTCTCGAGAACCAGCTTGATATACATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-365s1c1
Sequence:CCGGGCTGCCATTCTGACTCACATACTCGAGTATGTGAGTCAGAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-996s1c1
Sequence:CCGGGCTTGGTTTCTCGTCAGACATCTCGAGATGTCTGACGAGAAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1693s1c1
Sequence:CCGGCCCTTCCAATCTAAATGGAATCTCGAGATTCCATTTAGATTGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009640
ANGPT1 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-783s1c1
Sequence:CCGGCCCAGGTACTAAATCAAACATCTCGAGATGTTTGATTTAGTACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1194s1c1
Sequence:CCGGCGGATGTATATCAAGCTGGTTCTCGAGAACCAGCTTGATATACATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-365s1c1
Sequence:CCGGGCTGCCATTCTGACTCACATACTCGAGTATGTGAGTCAGAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-996s1c1
Sequence:CCGGGCTTGGTTTCTCGTCAGACATCTCGAGATGTCTGACGAGAAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009640.2-1693s1c1
Sequence:CCGGCCCTTCCAATCTAAATGGAATCTCGAGATTCCATTTAGATTGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)