EMAIL THIS PAGE TO A FRIEND

ANGPT2

angiopoietin 2

83 Gene Product Result for
Synonyms: AGPT2 ANG2
UniProtKB ID: O15123, A0AV38, A8K205, B7ZLM7, Q9NRR7, Q9P2Y7
Gene ID:
Human(285) Summary: The protein encoded by this gene is an antagonist of angiopoietin 1 (ANGPT1) and endothelial TEK tyrosine kinase (TIE-2, TEK). The encoded protein disrupts the vascular remodeling ability of ANGPT1 and may induce endothelial cell apoptosis. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11601) angiopoietin 2
Rat(89805) angiopoietin 2
chicken(395610) angiopoietin 2
cow(282141) angiopoietin 2
Horse(100051890) angiopoietin 2
dog(607616) angiopoietin 2
sheep(497273) angiopoietin 2
naked mole-rat(101710564) angiopoietin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001118887 Rosetta Predictions human pricing
NM_001118888 Rosetta Predictions human pricing
NM_001147 Rosetta Predictions human pricing
NM_134454 Rosetta Predictions rat pricing
NM_007426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327020 predicted 376
2 SASI_Hs02_00327021 predicted 1680
3 SASI_Hs02_00327022 predicted 1339
4 SASI_Hs02_00327023 predicted 1722
5 SASI_Hs02_00327024 predicted 1470
6 SASI_Hs02_00327025 predicted 1499
7 SASI_Hs02_00327026 predicted 1462
8 SASI_Hs02_00327027 predicted 1851
9 SASI_Hs02_00327028 predicted 1524
10 SASI_Hs02_00327029 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327030 predicted 374
2 SASI_Hs02_00327031 predicted 1521
3 SASI_Hs02_00327032 predicted 1182
4 SASI_Hs02_00327033 predicted 1563
5 SASI_Hs02_00327034 predicted 1311
6 SASI_Hs02_00327035 predicted 1343
7 SASI_Hs02_00327036 predicted 1309
8 SASI_Hs02_00327037 predicted 1699
9 SASI_Hs02_00327038 predicted 1364
10 SASI_Hs02_00327039 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331238 predicted 372
2 SASI_Hs02_00331239 predicted 1679
3 SASI_Hs02_00331240 predicted 1340
4 SASI_Hs01_00227853 predicted 1716
5 SASI_Hs02_00331241 predicted 1474
6 SASI_Hs01_00227855 predicted 1493
7 SASI_Hs02_00331242 predicted 1458
8 SASI_Hs01_00227856 predicted 1856
9 SASI_Hs01_00227858 predicted 1518
10 SASI_Hs02_00331243 predicted 1616
11 SASI_Hs01_00227849 predicted 623
12 SASI_Hs01_00227850 predicted 757
13 SASI_Hs01_00227851 predicted 744
14 SASI_Hs01_00227852 predicted 1656
15 SASI_Hs01_00227854 predicted 737
16 SASI_Hs01_00227857 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268036 predicted 1424
2 SASI_Rn02_00268037 predicted 1458
3 SASI_Rn02_00268038 predicted 1261
4 SASI_Rn02_00268039 predicted 546
5 SASI_Rn02_00268040 predicted 812
6 SASI_Rn02_00268041 predicted 544
7 SASI_Rn02_00268042 predicted 476
8 SASI_Rn02_00268043 predicted 602
9 SASI_Rn02_00268044 predicted 1252
10 SASI_Rn02_00268045 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099585 predicted 1095
2 SASI_Mm01_00099586 predicted 1626
3 SASI_Mm01_00099587 predicted 1469
4 SASI_Mm01_00099588 predicted 716
5 SASI_Mm01_00099589 predicted 1663
6 SASI_Mm01_00099590 predicted 1103
7 SASI_Mm01_00099592 predicted 1430
8 SASI_Mm01_00099593 predicted 631
9 SASI_Mm02_00311579 predicted 1454
10 SASI_Mm02_00311580 predicted 757
11 SASI_Mm01_00099591 predicted 1259
12 SASI_Mm01_00099594 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001147
ANGPT2 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000059223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1255s1c1
Sequence:CCGGCCCTAATTCTACAGAAGAGATCTCGAGATCTCTTCTGTAGAATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1496s1c1
Sequence:CCGGGCTTACTCATTGTATGAACATCTCGAGATGTTCATACAATGAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-718s1c1
Sequence:CCGGGATGATAGAAATAGGGACAAACTCGAGTTTGTCCCTATTTCTATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1058s1c1
Sequence:CCGGGCCACGGTGAATAATTCAGTTCTCGAGAACTGAATTATTCACCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001147
ANGPT2 MISSION shRNA shRNA Plasmid DNA
angiopoietin 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000059223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1255s1c1
Sequence:CCGGCCCTAATTCTACAGAAGAGATCTCGAGATCTCTTCTGTAGAATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1496s1c1
Sequence:CCGGGCTTACTCATTGTATGAACATCTCGAGATGTTCATACAATGAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-718s1c1
Sequence:CCGGGATGATAGAAATAGGGACAAACTCGAGTTTGTCCCTATTTCTATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1058s1c1
Sequence:CCGGGCCACGGTGAATAATTCAGTTCTCGAGAACTGAATTATTCACCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001147
ANGPT2 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000059223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1255s1c1
Sequence:CCGGCCCTAATTCTACAGAAGAGATCTCGAGATCTCTTCTGTAGAATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1496s1c1
Sequence:CCGGGCTTACTCATTGTATGAACATCTCGAGATGTTCATACAATGAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-718s1c1
Sequence:CCGGGATGATAGAAATAGGGACAAACTCGAGTTTGTCCCTATTTCTATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001147.1-1058s1c1
Sequence:CCGGGCCACGGTGAATAATTCAGTTCTCGAGAACTGAATTATTCACCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007426
VALIDATED
ANGPT2 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007426.2-319s1c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-609s1c1
Sequence:CCGGCCAACAGAATGTGGTGCAGAACTCGAGTTCTGCACCACATTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1087s1c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1380s1c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-2323s1c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007426.3-2323s21c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1087s21c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1380s21c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-319s21c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007426
VALIDATED
ANGPT2 MISSION shRNA shRNA Plasmid DNA
angiopoietin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007426.2-319s1c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-609s1c1
Sequence:CCGGCCAACAGAATGTGGTGCAGAACTCGAGTTCTGCACCACATTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1087s1c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1380s1c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-2323s1c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007426.3-2323s21c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1087s21c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1380s21c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-319s21c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007426
VALIDATED
ANGPT2 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007426.2-319s1c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-609s1c1
Sequence:CCGGCCAACAGAATGTGGTGCAGAACTCGAGTTCTGCACCACATTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1087s1c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-1380s1c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007426.2-2323s1c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007426.3-2323s21c1
Sequence:CCGGGCTGGCTACTATTTACTATATCTCGAGATATAGTAAATAGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1087s21c1
Sequence:CCGGGCTATCCGTAAAGAAGAGCAACTCGAGTTGCTCTTCTTTACGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-1380s21c1
Sequence:CCGGCGTGCTTAAGATCCAGCTGAACTCGAGTTCAGCTGGATCTTAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007426.3-319s21c1
Sequence:CCGGGCCTCAGCCTACAGTAACTTTCTCGAGAAAGTTACTGTAGGCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)