EMAIL THIS PAGE TO A FRIEND

ANGPT4

angiopoietin 4

53 Gene Product Result for
Synonyms: AGP4 ANG-3 ANG4
UniProtKB ID: Q9Y264, Q5TFF4, Q9H4Z4
Gene ID:
Human(51378) Summary: Angiopoietins are proteins with important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The mechanism by which they contribute to angiogenesis is thought to involve regulation of endothelial cell interactions with supporting perivascular cells. The protein encoded by this gene functions as an agonist and is an angiopoietin. [provided by RefSeq, Jul 2008]
Mouse(11602) angiopoietin 4
Rat(296269) angiopoietin 4
chicken(771763) angiopoietin 4
dog(609626) angiopoietin 4
domestic cat(101091274) angiopoietin 4
cow(617915) angiopoietin 4
sheep(101107460) angiopoietin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052211 MISSION® esiRNA esiRNA human ANGPT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015985 Rosetta Predictions human pricing
NM_001106526 Rosetta Predictions rat pricing
NM_009641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125704 predicted 1086
2 SASI_Hs01_00125705 predicted 1298
3 SASI_Hs01_00125706 predicted 1426
4 SASI_Hs01_00125707 predicted 1688
5 SASI_Hs01_00125708 predicted 1097
6 SASI_Hs01_00125709 predicted 1380
7 SASI_Hs01_00125710 predicted 1269
8 SASI_Hs01_00125711 predicted 1085
9 SASI_Hs02_00348659 predicted 231
10 SASI_Hs01_00125712 predicted 284
11 SASI_Hs01_00125713 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219828 predicted 317
2 SASI_Rn02_00219829 predicted 1542
3 SASI_Rn02_00219830 predicted 1918
4 SASI_Rn02_00219831 predicted 1533
5 SASI_Rn02_00219832 predicted 1529
6 SASI_Rn02_00219833 predicted 1433
7 SASI_Rn02_00219834 predicted 511
8 SASI_Rn02_00219835 predicted 1416
9 SASI_Rn02_00219836 predicted 1596
10 SASI_Rn02_00219837 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063872 predicted 194
2 SASI_Mm01_00063873 predicted 1225
3 SASI_Mm01_00063874 predicted 1296
4 SASI_Mm02_00316608 predicted 1223
5 SASI_Mm01_00063878 predicted 1304
6 SASI_Mm01_00063879 predicted 1054
7 SASI_Mm02_00316609 predicted 1178
8 SASI_Mm02_00316610 predicted 290
9 SASI_Mm01_00063881 predicted 1001
10 SASI_Mm02_00316611 predicted 1016
11 SASI_Mm01_00063875 predicted 301
12 SASI_Mm01_00063876 predicted 1139
13 SASI_Mm01_00063877 predicted 462
14 SASI_Mm01_00063880 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015985
ANGPT4 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1482s21c1
Sequence:CCGGCAAACCTCAACGGCGTCTACTCTCGAGAGTAGACGCCGTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1273s21c1
Sequence:CCGGCTATGCCCAGTACGAACATTTCTCGAGAAATGTTCGTACTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1132s1c1
Sequence:CCGGGCGGAACTGGAAGGATTACAACTCGAGTTGTAATCCTTCCAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-226s1c1
Sequence:CCGGCCACTGTAGCTACACCTTCTTCTCGAGAAGAAGGTGTAGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-571s1c1
Sequence:CCGGCCTGAACCAGACATCAAGAATCTCGAGATTCTTGATGTCTGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1585s1c1
Sequence:CCGGTCGCATGATGATACGGCCTTTCTCGAGAAAGGCCGTATCATCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1312s1c1
Sequence:CCGGCCAGCTATACAGGCTTTCTGTCTCGAGACAGAAAGCCTGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015985
ANGPT4 MISSION shRNA shRNA Plasmid DNA
angiopoietin 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1482s21c1
Sequence:CCGGCAAACCTCAACGGCGTCTACTCTCGAGAGTAGACGCCGTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1273s21c1
Sequence:CCGGCTATGCCCAGTACGAACATTTCTCGAGAAATGTTCGTACTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1132s1c1
Sequence:CCGGGCGGAACTGGAAGGATTACAACTCGAGTTGTAATCCTTCCAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-226s1c1
Sequence:CCGGCCACTGTAGCTACACCTTCTTCTCGAGAAGAAGGTGTAGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-571s1c1
Sequence:CCGGCCTGAACCAGACATCAAGAATCTCGAGATTCTTGATGTCTGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1585s1c1
Sequence:CCGGTCGCATGATGATACGGCCTTTCTCGAGAAAGGCCGTATCATCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1312s1c1
Sequence:CCGGCCAGCTATACAGGCTTTCTGTCTCGAGACAGAAAGCCTGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015985
ANGPT4 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1482s21c1
Sequence:CCGGCAAACCTCAACGGCGTCTACTCTCGAGAGTAGACGCCGTTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015985.2-1273s21c1
Sequence:CCGGCTATGCCCAGTACGAACATTTCTCGAGAAATGTTCGTACTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1132s1c1
Sequence:CCGGGCGGAACTGGAAGGATTACAACTCGAGTTGTAATCCTTCCAGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-226s1c1
Sequence:CCGGCCACTGTAGCTACACCTTCTTCTCGAGAAGAAGGTGTAGCTACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-571s1c1
Sequence:CCGGCCTGAACCAGACATCAAGAATCTCGAGATTCTTGATGTCTGGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1585s1c1
Sequence:CCGGTCGCATGATGATACGGCCTTTCTCGAGAAAGGCCGTATCATCATGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015985.2-1312s1c1
Sequence:CCGGCCAGCTATACAGGCTTTCTGTCTCGAGACAGAAAGCCTGTATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009641
ANGPT4 MISSION shRNA Bacterial Glycerol Stock
angiopoietin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-342s1c1
Sequence:CCGGGCAGTCCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-1326s1c1
Sequence:CCGGCAATGATAACTGCATGTGTAACTCGAGTTACACATGCAGTTATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-924s1c1
Sequence:CCGGCGGTGTCTATACCATCTATGACTCGAGTCATAGATGGTATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-673s1c1
Sequence:CCGGCTCCAAGAGAAGAGGGAACAACTCGAGTTGTTCCCTCTTCTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-851s1c1
Sequence:CCGGCGGTTTCCTTAAAGACACCTACTCGAGTAGGTGTCTTTAAGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009641
ANGPT4 MISSION shRNA shRNA Plasmid DNA
angiopoietin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-342s1c1
Sequence:CCGGGCAGTCCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-1326s1c1
Sequence:CCGGCAATGATAACTGCATGTGTAACTCGAGTTACACATGCAGTTATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-924s1c1
Sequence:CCGGCGGTGTCTATACCATCTATGACTCGAGTCATAGATGGTATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-673s1c1
Sequence:CCGGCTCCAAGAGAAGAGGGAACAACTCGAGTTGTTCCCTCTTCTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-851s1c1
Sequence:CCGGCGGTTTCCTTAAAGACACCTACTCGAGTAGGTGTCTTTAAGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009641
ANGPT4 MISSION shRNA Lentiviral Transduction Particles
angiopoietin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-342s1c1
Sequence:CCGGGCAGTCCATCAAGGTGAACTTCTCGAGAAGTTCACCTTGATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-1326s1c1
Sequence:CCGGCAATGATAACTGCATGTGTAACTCGAGTTACACATGCAGTTATCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-924s1c1
Sequence:CCGGCGGTGTCTATACCATCTATGACTCGAGTCATAGATGGTATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-673s1c1
Sequence:CCGGCTCCAAGAGAAGAGGGAACAACTCGAGTTGTTCCCTCTTCTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009641.1-851s1c1
Sequence:CCGGCGGTTTCCTTAAAGACACCTACTCGAGTAGGTGTCTTTAAGGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks