EMAIL THIS PAGE TO A FRIEND

ANGPTL1

angiopoietin-like 1

64 Gene Product Result for
Synonyms: ANG3 ANGPT3 ARP1 AngY UNQ162 dJ595C2.2
UniProtKB ID: O95841, Q5T5Z5
Gene ID:
Human(9068) Summary: Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
Mouse(72713) angiopoietin-like 1
Rat(679942) angiopoietin-like 1
sheep(101120347) angiopoietin-like 1
Domestic Rabbit(100347829) angiopoietin-like 1
domestic guinea pig(100727241) angiopoietin-like 1
naked mole-rat(101708101) angiopoietin-like 1
Zebrafish(544656) angiopoietin-like 1
domestic cat(101101535) angiopoietin-like 1
dog(612843) angiopoietin-like 1
cow(509971) angiopoietin-like 1
chicken(770850) angiopoietin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004673 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004673 Rosetta Predictions human pricing
NM_001109383 Rosetta Predictions rat pricing
NM_028333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186256 predicted 1793
2 SASI_Hs01_00186257 predicted 1759
3 SASI_Hs01_00186258 predicted 1283
4 SASI_Hs01_00186259 predicted 1642
5 SASI_Hs01_00186260 predicted 1702
6 SASI_Hs02_00338103 predicted 1304
7 SASI_Hs01_00186261 predicted 1554
8 SASI_Hs01_00186262 predicted 1739
9 SASI_Hs01_00186263 predicted 1925
10 SASI_Hs01_00186264 predicted 1823
11 SASI_Hs01_00186255 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247876 predicted 621
2 SASI_Rn02_00247877 predicted 852
3 SASI_Rn02_00247878 predicted 738
4 SASI_Rn02_00247879 predicted 996
5 SASI_Rn02_00247880 predicted 731
6 SASI_Rn02_00247881 predicted 836
7 SASI_Rn02_00247882 predicted 1032
8 SASI_Rn02_00247883 predicted 960
9 SASI_Rn02_00247884 predicted 632
10 SASI_Rn02_00247885 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073852 predicted 1464
2 SASI_Mm01_00073853 predicted 1554
3 SASI_Mm01_00073854 predicted 1687
4 SASI_Mm01_00073855 predicted 726
5 SASI_Mm01_00073856 predicted 1679
6 SASI_Mm01_00073857 predicted 1257
7 SASI_Mm01_00073858 predicted 1524
8 SASI_Mm01_00073859 predicted 1766
9 SASI_Mm01_00073860 predicted 1362
10 SASI_Mm01_00073861 predicted 1316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004673
ANGPTL1 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-1630s1c1
Sequence:CCGGGCTTTCGTCTGGAACCTGAAACTCGAGTTTCAGGTTCCAGACGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-830s1c1
Sequence:CCGGGCTGAGAAAGGAAAGCCGTAACTCGAGTTACGGCTTTCCTTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004673.3-2834s1c1
Sequence:CCGGCCCAACCAATCTGCAATTCAACTCGAGTTGAATTGCAGATTGGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-846s1c1
Sequence:CCGGCGTAACATGAACTCTCGTGTTCTCGAGAACACGAGAGTTCATGTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-981s1c1
Sequence:CCGGGCAACAAGATACAGGGAACTACTCGAGTAGTTCCCTGTATCTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-857s1c1
Sequence:CCGGCTCTCGTGTTACTCAACTCTACTCGAGTAGAGTTGAGTAACACGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-833s1c1
Sequence:CCGGGAGAAAGGAAAGCCGTAACATCTCGAGATGTTACGGCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-1699s21c1
Sequence:CCGGATTCTATGATGTGGCATAATGCTCGAGCATTATGCCACATCATAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-687s21c1
Sequence:CCGGCAAGATGCAAGTACCATTAAACTCGAGTTTAATGGTACTTGCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2147s21c1
Sequence:CCGGGTATCCACAACCTAGTTATTTCTCGAGAAATAACTAGGTTGTGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2109s21c1
Sequence:CCGGTAGTTTCATCTGTCGTCAATTCTCGAGAATTGACGACAGATGAAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004673
ANGPTL1 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-1630s1c1
Sequence:CCGGGCTTTCGTCTGGAACCTGAAACTCGAGTTTCAGGTTCCAGACGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-830s1c1
Sequence:CCGGGCTGAGAAAGGAAAGCCGTAACTCGAGTTACGGCTTTCCTTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004673.3-2834s1c1
Sequence:CCGGCCCAACCAATCTGCAATTCAACTCGAGTTGAATTGCAGATTGGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-846s1c1
Sequence:CCGGCGTAACATGAACTCTCGTGTTCTCGAGAACACGAGAGTTCATGTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-981s1c1
Sequence:CCGGGCAACAAGATACAGGGAACTACTCGAGTAGTTCCCTGTATCTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-857s1c1
Sequence:CCGGCTCTCGTGTTACTCAACTCTACTCGAGTAGAGTTGAGTAACACGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-833s1c1
Sequence:CCGGGAGAAAGGAAAGCCGTAACATCTCGAGATGTTACGGCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-1699s21c1
Sequence:CCGGATTCTATGATGTGGCATAATGCTCGAGCATTATGCCACATCATAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-687s21c1
Sequence:CCGGCAAGATGCAAGTACCATTAAACTCGAGTTTAATGGTACTTGCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2147s21c1
Sequence:CCGGGTATCCACAACCTAGTTATTTCTCGAGAAATAACTAGGTTGTGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2109s21c1
Sequence:CCGGTAGTTTCATCTGTCGTCAATTCTCGAGAATTGACGACAGATGAAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004673
ANGPTL1 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-1630s1c1
Sequence:CCGGGCTTTCGTCTGGAACCTGAAACTCGAGTTTCAGGTTCCAGACGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-830s1c1
Sequence:CCGGGCTGAGAAAGGAAAGCCGTAACTCGAGTTACGGCTTTCCTTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004673.3-2834s1c1
Sequence:CCGGCCCAACCAATCTGCAATTCAACTCGAGTTGAATTGCAGATTGGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-846s1c1
Sequence:CCGGCGTAACATGAACTCTCGTGTTCTCGAGAACACGAGAGTTCATGTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-981s1c1
Sequence:CCGGGCAACAAGATACAGGGAACTACTCGAGTAGTTCCCTGTATCTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004673.3-857s1c1
Sequence:CCGGCTCTCGTGTTACTCAACTCTACTCGAGTAGAGTTGAGTAACACGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004673.3-833s1c1
Sequence:CCGGGAGAAAGGAAAGCCGTAACATCTCGAGATGTTACGGCTTTCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-1699s21c1
Sequence:CCGGATTCTATGATGTGGCATAATGCTCGAGCATTATGCCACATCATAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004673.3-687s21c1
Sequence:CCGGCAAGATGCAAGTACCATTAAACTCGAGTTTAATGGTACTTGCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2147s21c1
Sequence:CCGGGTATCCACAACCTAGTTATTTCTCGAGAAATAACTAGGTTGTGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004673.3-2109s21c1
Sequence:CCGGTAGTTTCATCTGTCGTCAATTCTCGAGAATTGACGACAGATGAAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028333
ANGPTL1 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-647s1c1
Sequence:CCGGGAACATTGTAAACGAGGTGAACTCGAGTTCACCTCGTTTACAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-1119s1c1
Sequence:CCGGGCAGTGACTTTCATCAATGAACTCGAGTTCATTGATGAAAGTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-729s1c1
Sequence:CCGGCTACATGAGATCATCCGTAAACTCGAGTTTACGGATGATCTCATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028333.1-1103s1c1
Sequence:CCGGCCCTTTCAAGATTCCAGCAGTCTCGAGACTGCTGGAATCTTGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-674s1c1
Sequence:CCGGGAGAAAGGAAAGCCGGAACATCTCGAGATGTTCCGGCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1910s1c1
Sequence:CCGGGACTGAATATTGGTAAATGTACTCGAGTACATTTACCAATATTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1990s1c1
Sequence:CCGGGTTCAAGATACTTCATGATTTCTCGAGAAATCATGAAGTATCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1874s1c1
Sequence:CCGGGATTATGCAAATCCTTGTTATCTCGAGATAACAAGGATTTGCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028333
ANGPTL1 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-647s1c1
Sequence:CCGGGAACATTGTAAACGAGGTGAACTCGAGTTCACCTCGTTTACAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-1119s1c1
Sequence:CCGGGCAGTGACTTTCATCAATGAACTCGAGTTCATTGATGAAAGTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-729s1c1
Sequence:CCGGCTACATGAGATCATCCGTAAACTCGAGTTTACGGATGATCTCATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028333.1-1103s1c1
Sequence:CCGGCCCTTTCAAGATTCCAGCAGTCTCGAGACTGCTGGAATCTTGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-674s1c1
Sequence:CCGGGAGAAAGGAAAGCCGGAACATCTCGAGATGTTCCGGCTTTCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1910s1c1
Sequence:CCGGGACTGAATATTGGTAAATGTACTCGAGTACATTTACCAATATTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1990s1c1
Sequence:CCGGGTTCAAGATACTTCATGATTTCTCGAGAAATCATGAAGTATCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1874s1c1
Sequence:CCGGGATTATGCAAATCCTTGTTATCTCGAGATAACAAGGATTTGCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028333
ANGPTL1 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-647s1c1
Sequence:CCGGGAACATTGTAAACGAGGTGAACTCGAGTTCACCTCGTTTACAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-1119s1c1
Sequence:CCGGGCAGTGACTTTCATCAATGAACTCGAGTTCATTGATGAAAGTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-729s1c1
Sequence:CCGGCTACATGAGATCATCCGTAAACTCGAGTTTACGGATGATCTCATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028333.1-1103s1c1
Sequence:CCGGCCCTTTCAAGATTCCAGCAGTCTCGAGACTGCTGGAATCTTGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028333.1-674s1c1
Sequence:CCGGGAGAAAGGAAAGCCGGAACATCTCGAGATGTTCCGGCTTTCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1910s1c1
Sequence:CCGGGACTGAATATTGGTAAATGTACTCGAGTACATTTACCAATATTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216607    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1990s1c1
Sequence:CCGGGTTCAAGATACTTCATGATTTCTCGAGAAATCATGAAGTATCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028333.2-1874s1c1
Sequence:CCGGGATTATGCAAATCCTTGTTATCTCGAGATAACAAGGATTTGCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)