EMAIL THIS PAGE TO A FRIEND

ANGPTL2

angiopoietin-like 2

56 Gene Product Result for
Synonyms: ARP2 HARP
UniProtKB ID: Q9UKU9, Q5JT58
Gene ID:
Human(23452) Summary: Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
Mouse(26360) angiopoietin-like 2
Rat(171100) angiopoietin-like 2
chicken(776031) angiopoietin-like 2
cow(512019) angiopoietin-like 2
Horse(100067146) angiopoietin-like 2
domestic cat(101087361) angiopoietin-like 2
dog(480720) angiopoietin-like 2
naked mole-rat(101702312) angiopoietin-like 2
domestic guinea pig(100728986) angiopoietin-like 2
Domestic Rabbit(100354822) angiopoietin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1263 Human ANGPTL2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012098 Rosetta Predictions human pricing
NM_133569 Rosetta Predictions rat pricing
NM_011923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042802 predicted 837
2 SASI_Hs01_00042803 predicted 1859
3 SASI_Hs01_00042804 predicted 1645
4 SASI_Hs01_00042805 predicted 1620
5 SASI_Hs01_00042806 predicted 1778
6 SASI_Hs02_00343603 predicted 1654
7 SASI_Hs01_00042807 predicted 2046
8 SASI_Hs01_00042809 predicted 1878
9 SASI_Hs01_00042810 predicted 1572
10 SASI_Hs02_00343604 predicted 1499
11 SASI_Hs01_00042808 predicted 767
12 SASI_Hs01_00042811 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093799 predicted 1547
2 SASI_Rn01_00093800 predicted 492
3 SASI_Rn01_00093802 predicted 1803
4 SASI_Rn01_00093803 predicted 1384
5 SASI_Rn01_00093804 predicted 394
6 SASI_Rn01_00093805 predicted 1668
7 SASI_Rn01_00093806 predicted 536
8 SASI_Rn01_00093807 predicted 981
9 SASI_Rn01_00093808 predicted 586
10 SASI_Rn02_00267761 predicted 514
11 SASI_Rn01_00093801 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095184 predicted 1722
2 SASI_Mm01_00095185 predicted 635
3 SASI_Mm01_00095186 predicted 1686
4 SASI_Mm01_00095187 predicted 678
5 SASI_Mm01_00095188 predicted 1535
6 SASI_Mm01_00095189 predicted 1118
7 SASI_Mm01_00095190 predicted 1814
8 SASI_Mm01_00095191 predicted 542
9 SASI_Mm01_00095192 predicted 1654
10 SASI_Mm01_00095193 predicted 1242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011923
VALIDATED
ANGPTL2 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-639s21c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1694s21c1
Sequence:CCGGAGCCAGAAAGCGAGTACTATACTCGAGTATAGTACTCGCTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1605s21c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-2224s21c1
Sequence:CCGGCAGAGTCTTCCAATCAGTTAACTCGAGTTAACTGATTGGAAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1525s21c1
Sequence:CCGGAGGAACTGGGAGACCTATAAGCTCGAGCTTATAGGTCTCCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-700s1c1
Sequence:CCGGGCTCAACAATGAGCTGCTTAACTCGAGTTAAGCAGCTCATTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-1550s1c1
Sequence:CCGGCGTAAAGTCTTTGCTGAGTATCTCGAGATACTCAGCAAAGACTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-1498s1c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-532s1c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011923
VALIDATED
ANGPTL2 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-639s21c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1694s21c1
Sequence:CCGGAGCCAGAAAGCGAGTACTATACTCGAGTATAGTACTCGCTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1605s21c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-2224s21c1
Sequence:CCGGCAGAGTCTTCCAATCAGTTAACTCGAGTTAACTGATTGGAAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1525s21c1
Sequence:CCGGAGGAACTGGGAGACCTATAAGCTCGAGCTTATAGGTCTCCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-700s1c1
Sequence:CCGGGCTCAACAATGAGCTGCTTAACTCGAGTTAAGCAGCTCATTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-1550s1c1
Sequence:CCGGCGTAAAGTCTTTGCTGAGTATCTCGAGATACTCAGCAAAGACTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-1498s1c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-532s1c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011923
VALIDATED
ANGPTL2 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-639s21c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1694s21c1
Sequence:CCGGAGCCAGAAAGCGAGTACTATACTCGAGTATAGTACTCGCTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1605s21c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-2224s21c1
Sequence:CCGGCAGAGTCTTCCAATCAGTTAACTCGAGTTAACTGATTGGAAGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011923.4-1525s21c1
Sequence:CCGGAGGAACTGGGAGACCTATAAGCTCGAGCTTATAGGTCTCCCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-700s1c1
Sequence:CCGGGCTCAACAATGAGCTGCTTAACTCGAGTTAAGCAGCTCATTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011923.2-1550s1c1
Sequence:CCGGCGTAAAGTCTTTGCTGAGTATCTCGAGATACTCAGCAAAGACTTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-1498s1c1
Sequence:CCGGGACGAACCAAGGCAACTACAACTCGAGTTGTAGTTGCCTTGGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011923.2-532s1c1
Sequence:CCGGGAGAGAGTACATTTACCTCAACTCGAGTTGAGGTAAATGTACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012098
ANGPTL2 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3145s1c1
Sequence:CCGGCCGCATCTCATCTCCAAACTACTCGAGTAGTTTGGAGATGAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1621s1c1
Sequence:CCGGGCCGCAAAGTCTTTGCAGAATCTCGAGATTCTGCAAAGACTTTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-603s1c1
Sequence:CCGGCCAAGAGAGTTCATTTACCTACTCGAGTAGGTAAATGAACTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1631s1c1
Sequence:CCGGCTTTGCAGAATACGCCAGTTTCTCGAGAAACTGGCGTATTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-602s1c1
Sequence:CCGGGCCAAGAGAGTTCATTTACCTCTCGAGAGGTAAATGAACTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1195s1c1
Sequence:CCGGGCATCATCAACCAGATCTCTACTCGAGTAGAGATCTGGTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3050s1c1
Sequence:CCGGGCCAGGAGAATTATCTCAGAACTCGAGTTCTGAGATAATTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-598s1c1
Sequence:CCGGGCTCGCCAAGAGAGTTCATTTCTCGAGAAATGAACTCTCTTGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1500s1c1
Sequence:CCGGGAGACGTACAAGCAAGGGTTTCTCGAGAAACCCTTGCTTGTACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1205s1c1
Sequence:CCGGCCAGATCTCTACCAACGAGATCTCGAGATCTCGTTGGTAGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012098
ANGPTL2 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3145s1c1
Sequence:CCGGCCGCATCTCATCTCCAAACTACTCGAGTAGTTTGGAGATGAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1621s1c1
Sequence:CCGGGCCGCAAAGTCTTTGCAGAATCTCGAGATTCTGCAAAGACTTTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-603s1c1
Sequence:CCGGCCAAGAGAGTTCATTTACCTACTCGAGTAGGTAAATGAACTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1631s1c1
Sequence:CCGGCTTTGCAGAATACGCCAGTTTCTCGAGAAACTGGCGTATTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-602s1c1
Sequence:CCGGGCCAAGAGAGTTCATTTACCTCTCGAGAGGTAAATGAACTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1195s1c1
Sequence:CCGGGCATCATCAACCAGATCTCTACTCGAGTAGAGATCTGGTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3050s1c1
Sequence:CCGGGCCAGGAGAATTATCTCAGAACTCGAGTTCTGAGATAATTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-598s1c1
Sequence:CCGGGCTCGCCAAGAGAGTTCATTTCTCGAGAAATGAACTCTCTTGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1500s1c1
Sequence:CCGGGAGACGTACAAGCAAGGGTTTCTCGAGAAACCCTTGCTTGTACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1205s1c1
Sequence:CCGGCCAGATCTCTACCAACGAGATCTCGAGATCTCGTTGGTAGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012098
ANGPTL2 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164237    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3145s1c1
Sequence:CCGGCCGCATCTCATCTCCAAACTACTCGAGTAGTTTGGAGATGAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1621s1c1
Sequence:CCGGGCCGCAAAGTCTTTGCAGAATCTCGAGATTCTGCAAAGACTTTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-603s1c1
Sequence:CCGGCCAAGAGAGTTCATTTACCTACTCGAGTAGGTAAATGAACTCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1631s1c1
Sequence:CCGGCTTTGCAGAATACGCCAGTTTCTCGAGAAACTGGCGTATTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-602s1c1
Sequence:CCGGGCCAAGAGAGTTCATTTACCTCTCGAGAGGTAAATGAACTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1195s1c1
Sequence:CCGGGCATCATCAACCAGATCTCTACTCGAGTAGAGATCTGGTTGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161263    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012098.2-3050s1c1
Sequence:CCGGGCCAGGAGAATTATCTCAGAACTCGAGTTCTGAGATAATTCTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-598s1c1
Sequence:CCGGGCTCGCCAAGAGAGTTCATTTCTCGAGAAATGAACTCTCTTGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1500s1c1
Sequence:CCGGGAGACGTACAAGCAAGGGTTTCTCGAGAAACCCTTGCTTGTACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012098.2-1205s1c1
Sequence:CCGGCCAGATCTCTACCAACGAGATCTCGAGATCTCGTTGGTAGAGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks