EMAIL THIS PAGE TO A FRIEND

ANGPTL3

angiopoietin-like 3

56 Gene Product Result for
Synonyms: ANG-5 ANGPT5 ANL3 FHBL2
UniProtKB ID: Q9Y5C1
Gene ID:
Human(27329) Summary: This gene encodes a member of a family of secreted proteins that function in angiogenesis. The encoded protein, which is expressed predominantly in the liver, is further processed into an N-terminal coiled-coil domain-containing chain and a C-terminal fibrinogen chain. The N-terminal chain is important for lipid metablism, while the C-terminal chain may be involved in angiogenesis. Mutations in this gene cause familial hypobetalipoproteinemia type 2. [provided by RefSeq, Feb 2013]
Mouse(30924) angiopoietin-like 3
Rat(502970) angiopoietin-like 3
Zebrafish(114421) angiopoietin-like 3
dog(479547) angiopoietin-like 3
domestic cat(101081151) angiopoietin-like 3
cow(782603) angiopoietin-like 3
Horse(100054159) angiopoietin-like 3
chicken(100189558) angiopoietin-like 3
sheep(101107481) angiopoietin-like 3
Domestic Rabbit(100358107) angiopoietin-like 3
domestic guinea pig(100721758) angiopoietin-like 3
naked mole-rat(101717388) angiopoietin-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017381 MISSION® esiRNA esiRNA targeting human ANGPTL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014495 Rosetta Predictions human pricing
NM_001025065 Rosetta Predictions rat pricing
NM_013913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061010 predicted 212
2 SASI_Hs01_00061011 predicted 855
3 SASI_Hs01_00061012 predicted 1125
4 SASI_Hs02_00345745 predicted 477
5 SASI_Hs01_00061014 predicted 517
6 SASI_Hs02_00345746 predicted 340
7 SASI_Hs01_00061016 predicted 1216
8 SASI_Hs01_00061017 predicted 1011
9 SASI_Hs01_00061018 predicted 351
10 SASI_Hs01_00061019 predicted 221
11 SASI_Hs01_00061013 predicted 388
12 SASI_Hs01_00061015 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202996 predicted 975
2 SASI_Rn01_00052575 predicted 263
3 SASI_Rn01_00052576 predicted 325
4 SASI_Rn01_00052578 predicted 830
5 SASI_Rn01_00052579 predicted 780
6 SASI_Rn01_00052580 predicted 228
7 SASI_Rn01_00052581 predicted 653
8 SASI_Rn01_00052582 predicted 804
9 SASI_Rn02_00202997 predicted 396
10 SASI_Rn01_00052583 predicted 340
11 SASI_Rn01_00052574 predicted 612
12 SASI_Rn01_00052577 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053490 predicted 615
2 SASI_Mm01_00053491 predicted 242
3 SASI_Mm01_00053492 predicted 804
4 SASI_Mm01_00053493 predicted 391
5 SASI_Mm02_00323009 predicted 390
6 SASI_Mm01_00053494 predicted 1008
7 SASI_Mm01_00053495 predicted 1132
8 SASI_Mm01_00053496 predicted 997
9 SASI_Mm01_00053497 predicted 1121
10 SASI_Mm01_00053498 predicted 836
11 SASI_Mm01_00053499 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014495
ANGPTL3 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-781s1c1
Sequence:CCGGGCTGAATGTACCACCATTTATCTCGAGATAAATGGTGGTACATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014495.2-1839s1c1
Sequence:CCGGCTAAATACAGAGGACTGGTAACTCGAGTTACCAGTCCTCTGTATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-523s1c1
Sequence:CCGGCACCCAGAAGTAACTTCACTTCTCGAGAAGTGAAGTTACTTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-247s21c1
Sequence:CCGGGGCCAAATTAATGACATATTTCTCGAGAAATATGTCATTAATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-1365s21c1
Sequence:CCGGTGGAAGGTTATACTCTATAAACTCGAGTTTATAGAGTATAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-162s21c1
Sequence:CCGGTGCTATGTTAGACGATGTAAACTCGAGTTTACATCGTCTAACATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-591s21c1
Sequence:CCGGGACCGTGGAAGACCAATATAACTCGAGTTATATTGGTCTTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014495.2-1481s21c1
Sequence:CCGGCAAGTTAATGTGGTCTAATAACTCGAGTTATTAGACCACATTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014495
ANGPTL3 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-781s1c1
Sequence:CCGGGCTGAATGTACCACCATTTATCTCGAGATAAATGGTGGTACATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014495.2-1839s1c1
Sequence:CCGGCTAAATACAGAGGACTGGTAACTCGAGTTACCAGTCCTCTGTATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-523s1c1
Sequence:CCGGCACCCAGAAGTAACTTCACTTCTCGAGAAGTGAAGTTACTTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-247s21c1
Sequence:CCGGGGCCAAATTAATGACATATTTCTCGAGAAATATGTCATTAATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-1365s21c1
Sequence:CCGGTGGAAGGTTATACTCTATAAACTCGAGTTTATAGAGTATAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-162s21c1
Sequence:CCGGTGCTATGTTAGACGATGTAAACTCGAGTTTACATCGTCTAACATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-591s21c1
Sequence:CCGGGACCGTGGAAGACCAATATAACTCGAGTTATATTGGTCTTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014495.2-1481s21c1
Sequence:CCGGCAAGTTAATGTGGTCTAATAACTCGAGTTATTAGACCACATTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014495
ANGPTL3 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-781s1c1
Sequence:CCGGGCTGAATGTACCACCATTTATCTCGAGATAAATGGTGGTACATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014495.2-1839s1c1
Sequence:CCGGCTAAATACAGAGGACTGGTAACTCGAGTTACCAGTCCTCTGTATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014495.2-523s1c1
Sequence:CCGGCACCCAGAAGTAACTTCACTTCTCGAGAAGTGAAGTTACTTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-247s21c1
Sequence:CCGGGGCCAAATTAATGACATATTTCTCGAGAAATATGTCATTAATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-1365s21c1
Sequence:CCGGTGGAAGGTTATACTCTATAAACTCGAGTTTATAGAGTATAACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-162s21c1
Sequence:CCGGTGCTATGTTAGACGATGTAAACTCGAGTTTACATCGTCTAACATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014495.2-591s21c1
Sequence:CCGGGACCGTGGAAGACCAATATAACTCGAGTTATATTGGTCTTCCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014495.2-1481s21c1
Sequence:CCGGCAAGTTAATGTGGTCTAATAACTCGAGTTATTAGACCACATTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013913
ANGPTL3 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-760s1c1
Sequence:CCGGGCCGTTTATAACAGAGGCGAACTCGAGTTCGCCTCTGTTATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-492s1c1
Sequence:CCGGCCCAGAAGTAACATCACTCAACTCGAGTTGAGTGATGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-493s1c1
Sequence:CCGGCCAGAAGTAACATCACTCAAACTCGAGTTTGAGTGATGTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-201s1c1
Sequence:CCGGCCATAAGACTAAGGGACAAATCTCGAGATTTGTCCCTTAGTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013913
ANGPTL3 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-760s1c1
Sequence:CCGGGCCGTTTATAACAGAGGCGAACTCGAGTTCGCCTCTGTTATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-492s1c1
Sequence:CCGGCCCAGAAGTAACATCACTCAACTCGAGTTGAGTGATGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-493s1c1
Sequence:CCGGCCAGAAGTAACATCACTCAAACTCGAGTTTGAGTGATGTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-201s1c1
Sequence:CCGGCCATAAGACTAAGGGACAAATCTCGAGATTTGTCCCTTAGTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013913
ANGPTL3 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-760s1c1
Sequence:CCGGGCCGTTTATAACAGAGGCGAACTCGAGTTCGCCTCTGTTATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-492s1c1
Sequence:CCGGCCCAGAAGTAACATCACTCAACTCGAGTTGAGTGATGTTACTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-493s1c1
Sequence:CCGGCCAGAAGTAACATCACTCAAACTCGAGTTTGAGTGATGTTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013913.1-201s1c1
Sequence:CCGGCCATAAGACTAAGGGACAAATCTCGAGATTTGTCCCTTAGTCTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks