EMAIL THIS PAGE TO A FRIEND

ANGPTL4

angiopoietin-like 4

156 Gene Product Result for
Synonyms: ANGPTL2 ARP4 FIAF HARP HFARP NL2 PGAR UNQ171 pp1158
Gene ID:
Human(51129) Summary: This gene is a member of the angiopoietin/angiopoietin-like gene family and encodes a glycosylated, secreted protein with a fibrinogen C-terminal domain. This gene is induced under hypoxic conditions in endothelial cells and is the target of peroxisome proliferation activators. The encoded protein is a serum hormone directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity and also acts as an apoptosis survival factor for vascular endothelial cells. The encoded protein may play a role in several cancers and it also has been shown to prevent the metastatic process by inhibiting vascular activity as well as tumor cell motility and invasiveness. Decreased expression of this protein has been associated with type 2 diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Jul 2008]
Mouse(57875) angiopoietin-like 4
Rat(362850) angiopoietin-like 4
naked mole-rat(101718658) angiopoietin-like 4
domestic guinea pig(100733453) angiopoietin-like 4
Goat(100860916) angiopoietin-like 4
sheep(101104317) angiopoietin-like 4
Zebrafish(492647) angiopoietin-like 4
domestic cat(101090747) angiopoietin-like 4
cow(509963) angiopoietin-like 4
dog(476724) angiopoietin-like 4
chicken(769087) angiopoietin-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039667 Rosetta Predictions human pricing
NM_139314 Rosetta Predictions human pricing
NM_199115 Rosetta Predictions rat pricing
NM_020581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144609 predicted 1532
2 SASI_Hs01_00144611 predicted 1402
3 SASI_Hs01_00144612 predicted 1085
4 SASI_Hs01_00144614 predicted 1340
5 SASI_Hs01_00144615 predicted 1203
6 SASI_Hs02_00308628 predicted 1484
7 SASI_Hs01_00144617 predicted 1051
8 SASI_Hs01_00144618 predicted 1160
9 SASI_Hs02_00308629 predicted 1320
10 SASI_Hs02_00308630 predicted 1153
11 SASI_Hs01_00144610 predicted 971
12 SASI_Hs01_00144613 predicted 1115
13 SASI_Hs01_00144616 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240556 predicted 1652
2 SASI_Hs01_00240558 predicted 1517
3 SASI_Hs01_00240559 predicted 1198
4 SASI_Hs01_00240561 predicted 1456
5 SASI_Hs01_00240562 predicted 1322
6 SASI_Hs02_00364282 predicted 1606
7 SASI_Hs01_00240564 predicted 1174
8 SASI_Hs01_00240565 predicted 1279
9 SASI_Hs02_00364283 predicted 1439
10 SASI_Hs02_00364284 predicted 1271
11 SASI_Hs01_00240557 predicted 1093
12 SASI_Hs01_00240560 predicted 1226
13 SASI_Hs01_00240563 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270140 predicted 1391
2 SASI_Rn01_00061123 predicted 638
3 SASI_Rn01_00061124 predicted 519
4 SASI_Rn01_00061125 predicted 986
5 SASI_Rn01_00061127 predicted 848
6 SASI_Rn02_00270141 predicted 466
7 SASI_Rn01_00061128 predicted 806
8 SASI_Rn01_00061130 predicted 528
9 SASI_Rn01_00061131 predicted 1199
10 SASI_Rn02_00270142 predicted 1102
11 SASI_Rn01_00061122 predicted 1575
12 SASI_Rn01_00061126 predicted 1213
13 SASI_Rn01_00061129 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141474 predicted 517
2 SASI_Mm01_00141475 predicted 1555
3 SASI_Mm01_00141476 predicted 790
4 SASI_Mm01_00141478 predicted 1523
5 SASI_Mm01_00141479 predicted 1599
6 SASI_Mm01_00141480 predicted 509
7 SASI_Mm01_00141481 predicted 1443
8 SASI_Mm01_00141482 predicted 627
9 SASI_Mm01_00141483 predicted 649
10 SASI_Mm02_00325650 predicted 575
11 SASI_Mm01_00141477 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139314
ANGPTL4 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139314.1-1443s21c1
Sequence:CCGGCCACGAAAGACGGTGACTCTTCTCGAGAAGAGTCACCGTCTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1519s1c1
Sequence:CCGGCCATCTGGAAACTTGTGGACACTCGAGTGTCCACAAGTTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139314.1-540s1c1
Sequence:CCGGGATCCAGCAACTCTTCCACAACTCGAGTTGTGGAAGAGTTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-786s1c1
Sequence:CCGGGCAGAGTGGACTATTTGAAATCTCGAGATTTCAAATAGTCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-1311s1c1
Sequence:CCGGGAAGCTTAAGAAGGGAATCTTCTCGAGAAGATTCCCTTCTTAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-781s1c1
Sequence:CCGGGAGAGGCAGAGTGGACTATTTCTCGAGAAATAGTCCACTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1618s1c1
Sequence:CCGGGCAGGATATGCTCAGACTCTACTCGAGTAGAGTCTGAGCATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139314
ANGPTL4 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139314.1-1443s21c1
Sequence:CCGGCCACGAAAGACGGTGACTCTTCTCGAGAAGAGTCACCGTCTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1519s1c1
Sequence:CCGGCCATCTGGAAACTTGTGGACACTCGAGTGTCCACAAGTTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139314.1-540s1c1
Sequence:CCGGGATCCAGCAACTCTTCCACAACTCGAGTTGTGGAAGAGTTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-786s1c1
Sequence:CCGGGCAGAGTGGACTATTTGAAATCTCGAGATTTCAAATAGTCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-1311s1c1
Sequence:CCGGGAAGCTTAAGAAGGGAATCTTCTCGAGAAGATTCCCTTCTTAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-781s1c1
Sequence:CCGGGAGAGGCAGAGTGGACTATTTCTCGAGAAATAGTCCACTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1618s1c1
Sequence:CCGGGCAGGATATGCTCAGACTCTACTCGAGTAGAGTCTGAGCATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139314
ANGPTL4 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139314.1-1443s21c1
Sequence:CCGGCCACGAAAGACGGTGACTCTTCTCGAGAAGAGTCACCGTCTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1519s1c1
Sequence:CCGGCCATCTGGAAACTTGTGGACACTCGAGTGTCCACAAGTTTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139314.1-540s1c1
Sequence:CCGGGATCCAGCAACTCTTCCACAACTCGAGTTGTGGAAGAGTTGCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-786s1c1
Sequence:CCGGGCAGAGTGGACTATTTGAAATCTCGAGATTTCAAATAGTCCACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-1311s1c1
Sequence:CCGGGAAGCTTAAGAAGGGAATCTTCTCGAGAAGATTCCCTTCTTAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139314.1-781s1c1
Sequence:CCGGGAGAGGCAGAGTGGACTATTTCTCGAGAAATAGTCCACTCTGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139314.1-1618s1c1
Sequence:CCGGGCAGGATATGCTCAGACTCTACTCGAGTAGAGTCTGAGCATATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020581
VALIDATED
ANGPTL4 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1373s1c1
Sequence:CCGGGCCTAAGAAGACAGTGACTTTCTCGAGAAAGTCACTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-508s1c1
Sequence:CCGGAGATACCTATCAAAGCAGAATCTCGAGATTCTGCTTTGATAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020581.1-984s1c1
Sequence:CCGGGCTCCAATTTCCCATCCATTTCTCGAGAAATGGATGGGAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1192s1c1
Sequence:CCGGCATTCCAATCTCAATGGACAACTCGAGTTGTCCATTGAGATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-501s1c1
Sequence:CCGGGCAGCAGAGATACCTATCAAACTCGAGTTTGATAGGTATCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020581
VALIDATED
ANGPTL4 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1373s1c1
Sequence:CCGGGCCTAAGAAGACAGTGACTTTCTCGAGAAAGTCACTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-508s1c1
Sequence:CCGGAGATACCTATCAAAGCAGAATCTCGAGATTCTGCTTTGATAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020581.1-984s1c1
Sequence:CCGGGCTCCAATTTCCCATCCATTTCTCGAGAAATGGATGGGAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1192s1c1
Sequence:CCGGCATTCCAATCTCAATGGACAACTCGAGTTGTCCATTGAGATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-501s1c1
Sequence:CCGGGCAGCAGAGATACCTATCAAACTCGAGTTTGATAGGTATCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020581
VALIDATED
ANGPTL4 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1373s1c1
Sequence:CCGGGCCTAAGAAGACAGTGACTTTCTCGAGAAAGTCACTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-508s1c1
Sequence:CCGGAGATACCTATCAAAGCAGAATCTCGAGATTCTGCTTTGATAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020581.1-984s1c1
Sequence:CCGGGCTCCAATTTCCCATCCATTTCTCGAGAAATGGATGGGAAATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-1192s1c1
Sequence:CCGGCATTCCAATCTCAATGGACAACTCGAGTTGTCCATTGAGATTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020581.1-501s1c1
Sequence:CCGGGCAGCAGAGATACCTATCAAACTCGAGTTTGATAGGTATCTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks