EMAIL THIS PAGE TO A FRIEND

ANGPTL6

angiopoietin-like 6

53 Gene Product Result for
Synonyms: AGF ARP5
UniProtKB ID: Q8NI99, A5PKV7, Q9BZZ0
Gene ID:
Mouse(70726) angiopoietin-like 6
Rat(298698) angiopoietin-like 6
naked mole-rat(101710907) angiopoietin-like 6
domestic guinea pig(100717685) angiopoietin-like 6
Goat(100860917) angiopoietin-like 6
sheep(101111541) angiopoietin-like 6
Zebrafish(561927) angiopoietin-like 6
cow(521472) angiopoietin-like 6
domestic cat(101088649) angiopoietin-like 6
dog(611293) angiopoietin-like 6
chicken(417458) angiopoietin-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031917 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031917 Rosetta Predictions human pricing
NM_001106702 Rosetta Predictions rat pricing
NM_145154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098436 predicted 1373
2 SASI_Hs02_00359047 predicted 1349
3 SASI_Hs01_00098437 predicted 1391
4 SASI_Hs01_00098438 predicted 797
5 SASI_Hs01_00098439 predicted 1621
6 SASI_Hs01_00098440 predicted 1492
7 SASI_Hs01_00098442 predicted 1357
8 SASI_Hs01_00098443 predicted 1439
9 SASI_Hs01_00098444 predicted 1027
10 SASI_Hs01_00098445 predicted 1348
11 SASI_Hs01_00098441 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221548 predicted 680
2 SASI_Rn02_00221549 predicted 576
3 SASI_Rn02_00221550 predicted 388
4 SASI_Rn02_00221551 predicted 756
5 SASI_Rn02_00221552 predicted 1207
6 SASI_Rn02_00221553 predicted 1027
7 SASI_Rn02_00221554 predicted 1161
8 SASI_Rn02_00221555 predicted 687
9 SASI_Rn02_00221556 predicted 1068
10 SASI_Rn02_00221557 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191640 predicted 1238
2 SASI_Mm01_00191641 predicted 1274
3 SASI_Mm02_00340579 predicted 567
4 SASI_Mm01_00191642 predicted 841
5 SASI_Mm02_00340580 predicted 1234
6 SASI_Mm02_00340581 predicted 1251
7 SASI_Mm02_00340582 predicted 1262
8 SASI_Mm01_00191644 predicted 1282
9 SASI_Mm01_00191646 predicted 1185
10 SASI_Mm01_00191647 predicted 962
11 SASI_Mm01_00191643 predicted 1227
12 SASI_Mm01_00191645 predicted 760
13 SASI_Mm01_00191648 predicted 879
14 SASI_Mm01_00191649 predicted 251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031917
ANGPTL6 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-829s21c1
Sequence:CCGGACCAGTGACACCAGTAGGATGCTCGAGCATCCTACTGGTGTCACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-1338s21c1
Sequence:CCGGTGATGCTGGAGACTCTCTTTCCTCGAGGAAAGAGAGTCTCCAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1398s1c1
Sequence:CCGGCCGAGACTCCTATTCTGGTAACTCGAGTTACCAGAATAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-997s1c1
Sequence:CCGGGAACAGAGTGGAGTGTATGAACTCGAGTTCATACACTCCACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1402s1c1
Sequence:CCGGGACTCCTATTCTGGTAACTGTCTCGAGACAGTTACCAGAATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1106s1c1
Sequence:CCGGGTTCAGTCAACTTCTTCACTACTCGAGTAGTGAAGAAGTTGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1109s1c1
Sequence:CCGGCAGTCAACTTCTTCACTACCTCTCGAGAGGTAGTGAAGAAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031917.2-1664s21c1
Sequence:CCGGGTTCTGGCCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGGCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031917
ANGPTL6 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-829s21c1
Sequence:CCGGACCAGTGACACCAGTAGGATGCTCGAGCATCCTACTGGTGTCACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-1338s21c1
Sequence:CCGGTGATGCTGGAGACTCTCTTTCCTCGAGGAAAGAGAGTCTCCAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1398s1c1
Sequence:CCGGCCGAGACTCCTATTCTGGTAACTCGAGTTACCAGAATAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-997s1c1
Sequence:CCGGGAACAGAGTGGAGTGTATGAACTCGAGTTCATACACTCCACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1402s1c1
Sequence:CCGGGACTCCTATTCTGGTAACTGTCTCGAGACAGTTACCAGAATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1106s1c1
Sequence:CCGGGTTCAGTCAACTTCTTCACTACTCGAGTAGTGAAGAAGTTGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1109s1c1
Sequence:CCGGCAGTCAACTTCTTCACTACCTCTCGAGAGGTAGTGAAGAAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031917.2-1664s21c1
Sequence:CCGGGTTCTGGCCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGGCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031917
ANGPTL6 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-829s21c1
Sequence:CCGGACCAGTGACACCAGTAGGATGCTCGAGCATCCTACTGGTGTCACTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031917.2-1338s21c1
Sequence:CCGGTGATGCTGGAGACTCTCTTTCCTCGAGGAAAGAGAGTCTCCAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1398s1c1
Sequence:CCGGCCGAGACTCCTATTCTGGTAACTCGAGTTACCAGAATAGGAGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-997s1c1
Sequence:CCGGGAACAGAGTGGAGTGTATGAACTCGAGTTCATACACTCCACTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1402s1c1
Sequence:CCGGGACTCCTATTCTGGTAACTGTCTCGAGACAGTTACCAGAATAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1106s1c1
Sequence:CCGGGTTCAGTCAACTTCTTCACTACTCGAGTAGTGAAGAAGTTGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031917.2-1109s1c1
Sequence:CCGGCAGTCAACTTCTTCACTACCTCTCGAGAGGTAGTGAAGAAGTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031917.2-1664s21c1
Sequence:CCGGGTTCTGGCCACACCTTCTTTGCTCGAGCAAAGAAGGTGTGGCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145154
VALIDATED
ANGPTL6 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1278s21c1
Sequence:CCGGTAGGGACAGAGACTCATATTCCTCGAGGAATATGAGTCTCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-881s21c1
Sequence:CCGGACTGGCAGAGTGGAGTGTATGCTCGAGCATACACTCCACTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1241s21c1
Sequence:CCGGTCTCTTGGCACAATGACAAACCTCGAGGTTTGTCATTGTGCCAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-1009s21c1
Sequence:CCGGACCAACTGGCAGCACTACAAGCTCGAGCTTGTAGTGCTGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1106s21c1
Sequence:CCGGACGAGCTGCTGATACTCCTAGCTCGAGCTAGGAGTATCAGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-999s1c1
Sequence:CCGGCAACTTCTTCACCAACTGGCACTCGAGTGCCAGTTGGTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1284s1c1
Sequence:CCGGCAGAGACTCATATTCTGGTAACTCGAGTTACCAGAATATGAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1276s1c1
Sequence:CCGGGATAGGGACAGAGACTCATATCTCGAGATATGAGTCTCTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145154
VALIDATED
ANGPTL6 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1278s21c1
Sequence:CCGGTAGGGACAGAGACTCATATTCCTCGAGGAATATGAGTCTCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-881s21c1
Sequence:CCGGACTGGCAGAGTGGAGTGTATGCTCGAGCATACACTCCACTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1241s21c1
Sequence:CCGGTCTCTTGGCACAATGACAAACCTCGAGGTTTGTCATTGTGCCAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-1009s21c1
Sequence:CCGGACCAACTGGCAGCACTACAAGCTCGAGCTTGTAGTGCTGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1106s21c1
Sequence:CCGGACGAGCTGCTGATACTCCTAGCTCGAGCTAGGAGTATCAGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-999s1c1
Sequence:CCGGCAACTTCTTCACCAACTGGCACTCGAGTGCCAGTTGGTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1284s1c1
Sequence:CCGGCAGAGACTCATATTCTGGTAACTCGAGTTACCAGAATATGAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1276s1c1
Sequence:CCGGGATAGGGACAGAGACTCATATCTCGAGATATGAGTCTCTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145154
VALIDATED
ANGPTL6 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1278s21c1
Sequence:CCGGTAGGGACAGAGACTCATATTCCTCGAGGAATATGAGTCTCTGTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-881s21c1
Sequence:CCGGACTGGCAGAGTGGAGTGTATGCTCGAGCATACACTCCACTCTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1241s21c1
Sequence:CCGGTCTCTTGGCACAATGACAAACCTCGAGGTTTGTCATTGTGCCAAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145154.2-1009s21c1
Sequence:CCGGACCAACTGGCAGCACTACAAGCTCGAGCTTGTAGTGCTGCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145154.2-1106s21c1
Sequence:CCGGACGAGCTGCTGATACTCCTAGCTCGAGCTAGGAGTATCAGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-999s1c1
Sequence:CCGGCAACTTCTTCACCAACTGGCACTCGAGTGCCAGTTGGTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1284s1c1
Sequence:CCGGCAGAGACTCATATTCTGGTAACTCGAGTTACCAGAATATGAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145154.1-1276s1c1
Sequence:CCGGGATAGGGACAGAGACTCATATCTCGAGATATGAGTCTCTGTCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks