EMAIL THIS PAGE TO A FRIEND

ANGPTL7

angiopoietin-like 7

37 Gene Product Result for
Synonyms: AngX CDT6 RP4-647M16.2 dJ647M16.1
UniProtKB ID: O43827, B2R9B2, Q4ZGK4
Gene ID:
Mouse(654812) angiopoietin-like 7
Rat(100360000) angiopoietin-like 7
Zebrafish(450053) angiopoietin-like 7
domestic cat(101098394) angiopoietin-like 7
cow(512698) angiopoietin-like 7
Horse(100051411) angiopoietin-like 7
dog(608972) angiopoietin-like 7
chicken(101750033) angiopoietin-like 7
chicken(101665320) angiopoietin-like 7
sheep(101113349) angiopoietin-like 7
domestic guinea pig(100717840) angiopoietin-like 7
naked mole-rat(101725236) angiopoietin-like 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1264 Human ANGPTL7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021146 Rosetta Predictions human pricing
NM_001039554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060514 predicted 1450
2 SASI_Hs01_00060515 predicted 953
3 SASI_Hs01_00060516 predicted 1570
4 SASI_Hs01_00060517 predicted 1071
5 SASI_Hs01_00060518 predicted 933
6 SASI_Hs01_00060520 predicted 746
7 SASI_Hs01_00060521 predicted 1546
8 SASI_Hs01_00060522 predicted 1432
9 SASI_Hs01_00060523 predicted 1192
10 SASI_Hs02_00354677 predicted 1469
11 SASI_Hs01_00060519 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290132 predicted 708
2 SASI_Mm02_00290133 predicted 851
3 SASI_Mm02_00290134 predicted 1444
4 SASI_Mm02_00290135 predicted 1479
5 SASI_Mm02_00290136 predicted 655
6 SASI_Mm02_00290137 predicted 861
7 SASI_Mm02_00290138 predicted 557
8 SASI_Mm02_00290139 predicted 559
9 SASI_Mm02_00290140 predicted 1389
10 SASI_Mm02_00290141 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021146
ANGPTL7 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-936s1c1
Sequence:CCGGGCTGAGTATAGCCACTTTGTTCTCGAGAACAAAGTGGCTATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-425s1c1
Sequence:CCGGGCTGAGTGAACTGAACAAGAACTCGAGTTCTTGTTCAGTTCACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1386s1c1
Sequence:CCGGCAGCCTATAATCTCCAAAGAACTCGAGTTCTTTGGAGATTATAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1573s1c1
Sequence:CCGGCCACATGATTTGTCTGTGAAACTCGAGTTTCACAGACAAATCATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-935s1c1
Sequence:CCGGCGCTGAGTATAGCCACTTTGTCTCGAGACAAAGTGGCTATACTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-317s1c1
Sequence:CCGGGCAGAAGCTCTCTAAGCACAACTCGAGTTGTGCTTAGAGAGCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-1019s21c1
Sequence:CCGGCGACGCCCTCCAGTATCATAACTCGAGTTATGATACTGGAGGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-546s21c1
Sequence:CCGGTCCGAGATGAACAACCAAATTCTCGAGAATTTGGTTGTTCATCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-655s21c1
Sequence:CCGGACCGCATCTCTGGAGTGTATACTCGAGTATACACTCCAGAGATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021146
ANGPTL7 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-936s1c1
Sequence:CCGGGCTGAGTATAGCCACTTTGTTCTCGAGAACAAAGTGGCTATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-425s1c1
Sequence:CCGGGCTGAGTGAACTGAACAAGAACTCGAGTTCTTGTTCAGTTCACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1386s1c1
Sequence:CCGGCAGCCTATAATCTCCAAAGAACTCGAGTTCTTTGGAGATTATAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1573s1c1
Sequence:CCGGCCACATGATTTGTCTGTGAAACTCGAGTTTCACAGACAAATCATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-935s1c1
Sequence:CCGGCGCTGAGTATAGCCACTTTGTCTCGAGACAAAGTGGCTATACTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-317s1c1
Sequence:CCGGGCAGAAGCTCTCTAAGCACAACTCGAGTTGTGCTTAGAGAGCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-1019s21c1
Sequence:CCGGCGACGCCCTCCAGTATCATAACTCGAGTTATGATACTGGAGGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-546s21c1
Sequence:CCGGTCCGAGATGAACAACCAAATTCTCGAGAATTTGGTTGTTCATCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-655s21c1
Sequence:CCGGACCGCATCTCTGGAGTGTATACTCGAGTATACACTCCAGAGATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021146
ANGPTL7 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-936s1c1
Sequence:CCGGGCTGAGTATAGCCACTTTGTTCTCGAGAACAAAGTGGCTATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-425s1c1
Sequence:CCGGGCTGAGTGAACTGAACAAGAACTCGAGTTCTTGTTCAGTTCACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146789    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1386s1c1
Sequence:CCGGCAGCCTATAATCTCCAAAGAACTCGAGTTCTTTGGAGATTATAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183663    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021146.2-1573s1c1
Sequence:CCGGCCACATGATTTGTCTGTGAAACTCGAGTTTCACAGACAAATCATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-935s1c1
Sequence:CCGGCGCTGAGTATAGCCACTTTGTCTCGAGACAAAGTGGCTATACTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021146.2-317s1c1
Sequence:CCGGGCAGAAGCTCTCTAAGCACAACTCGAGTTGTGCTTAGAGAGCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-1019s21c1
Sequence:CCGGCGACGCCCTCCAGTATCATAACTCGAGTTATGATACTGGAGGGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-546s21c1
Sequence:CCGGTCCGAGATGAACAACCAAATTCTCGAGAATTTGGTTGTTCATCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021146.2-655s21c1
Sequence:CCGGACCGCATCTCTGGAGTGTATACTCGAGTATACACTCCAGAGATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039554
ANGPTL7 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 7
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-701s21c1
Sequence:CCGGCCAAGACTGGAGACAGTATAACTCGAGTTATACTGTCTCCAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039554.3-1726s21c1
Sequence:CCGGTACCACCATACCCAGTATATACTCGAGTATATACTGGGTATGGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-1118s21c1
Sequence:CCGGCTGGCATGGAGCCAACTATTCCTCGAGGAATAGTTGGCTCCATGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-841s21c1
Sequence:CCGGACGCAGAGTATAGCTACTTTGCTCGAGCAAAGTAGCTATACTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039554
ANGPTL7 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 7
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-701s21c1
Sequence:CCGGCCAAGACTGGAGACAGTATAACTCGAGTTATACTGTCTCCAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039554.3-1726s21c1
Sequence:CCGGTACCACCATACCCAGTATATACTCGAGTATATACTGGGTATGGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-1118s21c1
Sequence:CCGGCTGGCATGGAGCCAACTATTCCTCGAGGAATAGTTGGCTCCATGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-841s21c1
Sequence:CCGGACGCAGAGTATAGCTACTTTGCTCGAGCAAAGTAGCTATACTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039554
ANGPTL7 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 7
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-701s21c1
Sequence:CCGGCCAAGACTGGAGACAGTATAACTCGAGTTATACTGTCTCCAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039554.3-1726s21c1
Sequence:CCGGTACCACCATACCCAGTATATACTCGAGTATATACTGGGTATGGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-1118s21c1
Sequence:CCGGCTGGCATGGAGCCAACTATTCCTCGAGGAATAGTTGGCTCCATGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039554.3-841s21c1
Sequence:CCGGACGCAGAGTATAGCTACTTTGCTCGAGCAAAGTAGCTATACTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)