EMAIL THIS PAGE TO A FRIEND

ANK1

ankyrin 1, erythrocytic

230 Gene Product Result for
Synonyms: ANK SPH1 SPH2
Gene ID:
Human(286) Summary: Ankyrins are a family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 1, the prototype of this family, was first discovered in the erythrocytes, but since has also been found in brain and muscles. Mutations in erythrocytic ankyrin 1 have been associated in approximately half of all patients with hereditary spherocytosis. Complex patterns of alternative splicing in the regulatory domain, giving rise to different isoforms of ankyrin 1 have been described. Truncated muscle-specific isoforms of ankyrin 1 resulting from usage of an alternate promoter have also been identified. [provided by RefSeq, Dec 2008]
Mouse(11733) ankyrin 1, erythroid
Rat(306570) ankyrin 1, erythrocytic
naked mole-rat(101714665) ankyrin 1, erythrocytic
domestic guinea pig(100725822) ankyrin 1, erythrocytic
sheep(101121569) ankyrin 1, erythrocytic
Zebrafish(449796) ankyrin 1, erythrocytic
cow(353108) ankyrin 1, erythrocytic
Horse(100055459) ankyrin 1, erythrocytic
dog(482842) ankyrin 1, erythrocytic
chicken(396311) ankyrin 1, erythrocytic
Thale Cress(831855) protein ankyrin-like1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000037 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099451 MISSION® esiRNA esiRNA human ANK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000037 Rosetta Predictions human pricing
NM_020475 Rosetta Predictions human pricing
NM_020476 Rosetta Predictions human pricing
NM_020477 Rosetta Predictions human pricing
NM_020478 Rosetta Predictions human pricing
NM_020479 Rosetta Predictions human pricing
NM_020480 Rosetta Predictions human pricing
NM_020481 Rosetta Predictions human pricing
NM_001107322 Rosetta Predictions rat pricing
NM_001110783 Rosetta Predictions mouse pricing
NM_031158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073411 predicted 3696
2 SASI_Hs01_00073412 predicted 3633
3 SASI_Hs02_00301722 predicted 1453
4 SASI_Hs01_00073413 predicted 150
5 SASI_Hs01_00073414 predicted 5554
6 SASI_Hs02_00301723 predicted 4232
7 SASI_Hs01_00073415 predicted 3787
8 SASI_Hs01_00073416 predicted 4978
9 SASI_Hs01_00073418 predicted 4967
10 SASI_Hs01_00073419 predicted 4022
11 SASI_Hs01_00073417 predicted 5282
12 SASI_Hs01_00073420 predicted 4614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187556 predicted 3695
2 SASI_Hs01_00187557 predicted 3633
3 SASI_Hs02_00353557 predicted 1450
4 SASI_Hs01_00187558 predicted 151
5 SASI_Hs01_00187559 predicted 5549
6 SASI_Hs02_00353558 predicted 4234
7 SASI_Hs01_00187560 predicted 3788
8 SASI_Hs01_00187561 predicted 4976
9 SASI_Hs01_00187563 predicted 4973
10 SASI_Hs01_00187564 predicted 4025
11 SASI_Hs01_00187562 predicted 5289
12 SASI_Hs01_00187565 predicted 4609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054282 predicted 3691
2 SASI_Hs01_00054283 predicted 3636
3 SASI_Hs02_00353559 predicted 1447
4 SASI_Hs01_00054284 predicted 142
5 SASI_Hs01_00054285 predicted 5545
6 SASI_Hs02_00353560 predicted 4236
7 SASI_Hs01_00054286 predicted 3784
8 SASI_Hs01_00054287 predicted 4975
9 SASI_Hs01_00054289 predicted 4969
10 SASI_Hs01_00054290 predicted 4025
11 SASI_Hs01_00054288 predicted 5287
12 SASI_Hs01_00054291 predicted 4611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099932 predicted 3697
2 SASI_Hs01_00099933 predicted 3639
3 SASI_Hs01_00099934 predicted 1450
4 SASI_Hs01_00099935 predicted 144
5 SASI_Hs01_00099936 predicted 5066
6 SASI_Hs01_00099937 predicted 4236
7 SASI_Hs01_00099938 predicted 3792
8 SASI_Hs01_00099940 predicted 4030
9 SASI_Hs01_00099941 predicted 4466
10 SASI_Hs02_00353561 predicted 3651
11 SASI_Hs01_00099939 predicted 4794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128588 predicted 605
2 SASI_Hs01_00128589 predicted 924
3 SASI_Hs01_00128590 predicted 832
4 SASI_Hs01_00128591 predicted 1508
5 SASI_Hs01_00128593 predicted 824
6 SASI_Hs01_00128594 predicted 847
7 SASI_Hs01_00128595 predicted 1197
8 SASI_Hs01_00128596 predicted 1241
9 SASI_Hs01_00128597 predicted 595
10 SASI_Hs02_00353562 predicted 1227
11 SASI_Hs01_00128592 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088394 predicted 613
2 SASI_Hs01_00088395 predicted 829
3 SASI_Hs01_00088396 predicted 862
4 SASI_Hs01_00088397 predicted 1442
5 SASI_Hs01_00088398 predicted 812
6 SASI_Hs01_00088399 predicted 1127
7 SASI_Hs01_00088400 predicted 1177
8 SASI_Hs01_00088401 predicted 608
9 SASI_Hs01_00088402 predicted 817
10 SASI_Hs01_00088403 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229888 predicted 599
2 SASI_Hs01_00229889 predicted 1359
3 SASI_Hs01_00229890 predicted 1316
4 SASI_Hs01_00229891 predicted 1304
5 SASI_Hs01_00229893 predicted 1309
6 SASI_Hs01_00229894 predicted 991
7 SASI_Hs01_00229895 predicted 818
8 SASI_Hs01_00229896 predicted 1042
9 SASI_Hs01_00229897 predicted 1360
10 SASI_Hs02_00353563 predicted 600
11 SASI_Hs01_00229892 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241256 predicted 960
2 SASI_Hs01_00241257 predicted 1853
3 SASI_Hs01_00241258 predicted 1444
4 SASI_Hs01_00241259 predicted 1329
5 SASI_Hs01_00241260 predicted 1284
6 SASI_Hs01_00241261 predicted 1807
7 SASI_Hs01_00241262 predicted 1977
8 SASI_Hs01_00241263 predicted 1851
9 SASI_Hs01_00241264 predicted 1445
10 SASI_Hs01_00241265 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227695 predicted 4585
2 SASI_Rn02_00227696 predicted 3494
3 SASI_Rn02_00227697 predicted 2139
4 SASI_Rn02_00227698 predicted 5001
5 SASI_Rn02_00227699 predicted 1638
6 SASI_Rn02_00227700 predicted 1684
7 SASI_Rn02_00227701 predicted 4686
8 SASI_Rn02_00227702 predicted 4567
9 SASI_Rn02_00227703 predicted 1156
10 SASI_Rn02_00227704 predicted 3984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305708 predicted 833
2 SASI_Mm02_00305709 predicted 4804
3 SASI_Mm02_00305710 predicted 739
4 SASI_Mm02_00305711 predicted 2677
5 SASI_Mm02_00305712 predicted 4146
6 SASI_Mm02_00305713 predicted 4790
7 SASI_Mm02_00305714 predicted 4703
8 SASI_Mm02_00305715 predicted 4847
9 SASI_Mm02_00305716 predicted 5774
10 SASI_Mm02_00305717 predicted 3964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336968 predicted 852
2 SASI_Mm01_00059180 predicted 4820
3 SASI_Mm02_00336969 predicted 758
4 SASI_Mm01_00059182 predicted 2694
5 SASI_Mm01_00059183 predicted 4158
6 SASI_Mm01_00059184 predicted 4806
7 SASI_Mm01_00059185 predicted 4728
8 SASI_Mm01_00059186 predicted 4861
9 SASI_Mm01_00059187 predicted 5700
10 SASI_Mm01_00059188 predicted 3978
11 SASI_Mm01_00059181 predicted 5278
12 SASI_Mm01_00059189 predicted 5751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031158
ANK1 MISSION shRNA Bacterial Glycerol Stock
ankyrin 1, erythrocytic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031158.1-7881s1c1
Sequence:CCGGCGTTGCTAGTAGGAGCTGTTTCTCGAGAAACAGCTCCTACTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1062s1c1
Sequence:CCGGCGTCAACTTCACACCTCAGAACTCGAGTTCTGAGGTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-3982s1c1
Sequence:CCGGGCCAATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1618s1c1
Sequence:CCGGCTTCCTATTGTGAAGAACTTACTCGAGTAAGTTCTTCACAATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1617s1c1
Sequence:CCGGCCTTCCTATTGTGAAGAACTTCTCGAGAAGTTCTTCACAATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031158
ANK1 MISSION shRNA shRNA Plasmid DNA
ankyrin 1, erythrocytic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031158.1-7881s1c1
Sequence:CCGGCGTTGCTAGTAGGAGCTGTTTCTCGAGAAACAGCTCCTACTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1062s1c1
Sequence:CCGGCGTCAACTTCACACCTCAGAACTCGAGTTCTGAGGTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-3982s1c1
Sequence:CCGGGCCAATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1618s1c1
Sequence:CCGGCTTCCTATTGTGAAGAACTTACTCGAGTAAGTTCTTCACAATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1617s1c1
Sequence:CCGGCCTTCCTATTGTGAAGAACTTCTCGAGAAGTTCTTCACAATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031158
ANK1 MISSION shRNA Lentiviral Transduction Particles
ankyrin 1, erythrocytic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031158.1-7881s1c1
Sequence:CCGGCGTTGCTAGTAGGAGCTGTTTCTCGAGAAACAGCTCCTACTAGCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1062s1c1
Sequence:CCGGCGTCAACTTCACACCTCAGAACTCGAGTTCTGAGGTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-3982s1c1
Sequence:CCGGGCCAATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1618s1c1
Sequence:CCGGCTTCCTATTGTGAAGAACTTACTCGAGTAAGTTCTTCACAATAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031158.1-1617s1c1
Sequence:CCGGCCTTCCTATTGTGAAGAACTTCTCGAGAAGTTCTTCACAATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000037
ANK1 MISSION shRNA Bacterial Glycerol Stock
ankyrin 1, erythrocytic
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2448s1c1
Sequence:CCGGCGTCACGGATGAAACCAGTTTCTCGAGAAACTGGTTTCATCCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-372s1c1
Sequence:CCGGGCTTGTCAACTATGGAGCCAACTCGAGTTGGCTCCATAGTTGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-777s1c1
Sequence:CCGGCGTCAATTTCACACCACAGAACTCGAGTTCTGTGGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000037.2-6481s1c1
Sequence:CCGGGCCAATTTCAATACGAATCATCTCGAGATGATTCGTATTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2465s1c1
Sequence:CCGGGTTTCGTGTTAGTCAGTGATACTCGAGTATCACTGACTAACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-1430s21c1
Sequence:CCGGACACGGAAGTGGCCAAATATTCTCGAGAATATTTGGCCACTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-4974s21c1
Sequence:CCGGCACAAATGGCCTTATCGATTTCTCGAGAAATCGATAAGGCCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000037
ANK1 MISSION shRNA shRNA Plasmid DNA
ankyrin 1, erythrocytic
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2448s1c1
Sequence:CCGGCGTCACGGATGAAACCAGTTTCTCGAGAAACTGGTTTCATCCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-372s1c1
Sequence:CCGGGCTTGTCAACTATGGAGCCAACTCGAGTTGGCTCCATAGTTGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-777s1c1
Sequence:CCGGCGTCAATTTCACACCACAGAACTCGAGTTCTGTGGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000037.2-6481s1c1
Sequence:CCGGGCCAATTTCAATACGAATCATCTCGAGATGATTCGTATTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2465s1c1
Sequence:CCGGGTTTCGTGTTAGTCAGTGATACTCGAGTATCACTGACTAACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-1430s21c1
Sequence:CCGGACACGGAAGTGGCCAAATATTCTCGAGAATATTTGGCCACTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-4974s21c1
Sequence:CCGGCACAAATGGCCTTATCGATTTCTCGAGAAATCGATAAGGCCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000037
ANK1 MISSION shRNA Lentiviral Transduction Particles
ankyrin 1, erythrocytic
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2448s1c1
Sequence:CCGGCGTCACGGATGAAACCAGTTTCTCGAGAAACTGGTTTCATCCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-372s1c1
Sequence:CCGGGCTTGTCAACTATGGAGCCAACTCGAGTTGGCTCCATAGTTGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-777s1c1
Sequence:CCGGCGTCAATTTCACACCACAGAACTCGAGTTCTGTGGTGTGAAATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000037.2-6481s1c1
Sequence:CCGGGCCAATTTCAATACGAATCATCTCGAGATGATTCGTATTGAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000037.2-2465s1c1
Sequence:CCGGGTTTCGTGTTAGTCAGTGATACTCGAGTATCACTGACTAACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-1430s21c1
Sequence:CCGGACACGGAAGTGGCCAAATATTCTCGAGAATATTTGGCCACTTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000037.3-4974s21c1
Sequence:CCGGCACAAATGGCCTTATCGATTTCTCGAGAAATCGATAAGGCCATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks