EMAIL THIS PAGE TO A FRIEND

ANK2

ankyrin 2, neuronal

306 Gene Product Result for
Synonyms: ANK-2 LQT4 brank-2
UniProtKB ID: Q01484, Q01485, Q08AC7, Q08AC8, Q7Z3L5
Gene ID:
Human(287) Summary: This gene encodes a member of the ankyrin family of proteins that link the integral membrane proteins to the underlying spectrin-actin cytoskeleton. Ankyrins play key roles in activities such as cell motility, activation, proliferation, contact and the maintenance of specialized membrane domains. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. The protein encoded by this gene is required for targeting and stability of Na/Ca exchanger 1 in cardiomyocytes. Mutations in this gene cause long QT syndrome 4 and cardiac arrhythmia syndrome. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2011]
Mouse(109676) ankyrin 2, brain
Rat(362036) ankyrin 2, neuronal
fruit fly(38863) Ankyrin 2
Horse(100064198) ankyrin 2, neuronal
domestic cat(101100129) ankyrin 2, neuronal
chicken(422689) ankyrin 2, neuronal
dog(487908) ankyrin 2, neuronal
sheep(101115623) ankyrin 2, neuronal
domestic guinea pig(100717265) ankyrin 2, neuronal
naked mole-rat(101697466) ankyrin 2, neuronal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008007 Anti-ANK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA035970 Anti-ANK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200375 Monoclonal Anti-Ankyrin B - Alkaline Phosphatase antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200376 Monoclonal Anti-Ankyrin B - Apc antibody produced in mouse clone S105-13, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200367 Monoclonal Anti-Ankyrin B - Atto 390 antibody produced in mouse clone S105-13, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200368 Monoclonal Anti-Ankyrin B - Atto 488 antibody produced in mouse clone S105-13, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200369 Monoclonal Anti-Ankyrin B - Atto 565 antibody produced in mouse clone S105-13, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200370 Monoclonal Anti-Ankyrin B - Atto 594 antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200371 Monoclonal Anti-Ankyrin B - Atto 633 antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200372 Monoclonal Anti-Ankyrin B - Atto 655 antibody produced in mouse clone S105-13, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200373 Monoclonal Anti-Ankyrin B - Atto 680 antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200374 Monoclonal Anti-Ankyrin B - Atto 700 antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200377 Monoclonal Anti-Ankyrin B - Biotin antibody produced in mouse clone S105-13, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200378 Monoclonal Anti-Ankyrin B - Fitc antibody produced in mouse clone S105-13, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200379 Monoclonal Anti-Ankyrin B - Hrp antibody produced in mouse clone S105-13, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200380 Monoclonal Anti-Ankyrin B - Pe/Atto 594 antibody produced in mouse clone S105-13, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200381 Monoclonal Anti-Ankyrin B - Percp antibody produced in mouse clone S105-13, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200382 Monoclonal Anti-Ankyrin B - Rpe antibody produced in mouse clone S105-13, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200383 Monoclonal Anti-Ankyrin B - Streptavidin antibody produced in mouse clone S105-13, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200366 Monoclonal Anti-Ankyrin B antibody produced in mouse clone S105-13, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200627 Monoclonal Anti-Ankyrin-B - Alkaline Phosphatase antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200628 Monoclonal Anti-Ankyrin-B - Apc antibody produced in mouse clone S105-17, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200619 Monoclonal Anti-Ankyrin-B - Atto 390 antibody produced in mouse clone S105-17, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200620 Monoclonal Anti-Ankyrin-B - Atto 488 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200621 Monoclonal Anti-Ankyrin-B - Atto 565 antibody produced in mouse clone S105-17, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200622 Monoclonal Anti-Ankyrin-B - Atto 594 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200623 Monoclonal Anti-Ankyrin-B - Atto 633 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200624 Monoclonal Anti-Ankyrin-B - Atto 655 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200625 Monoclonal Anti-Ankyrin-B - Atto 680 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200626 Monoclonal Anti-Ankyrin-B - Atto 700 antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200629 Monoclonal Anti-Ankyrin-B - Biotin antibody produced in mouse clone S105-17, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200630 Monoclonal Anti-Ankyrin-B - Fitc antibody produced in mouse clone S105-17, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200631 Monoclonal Anti-Ankyrin-B - Hrp antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200632 Monoclonal Anti-Ankyrin-B - Pe/Atto 594 antibody produced in mouse clone S105-17, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200633 Monoclonal Anti-Ankyrin-B - Percp antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200634 Monoclonal Anti-Ankyrin-B - Rpe antibody produced in mouse clone S105-17, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200635 Monoclonal Anti-Ankyrin-B - Streptavidin antibody produced in mouse clone S105-17, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200618 Monoclonal Anti-Ankyrin-B antibody produced in mouse clone S105-17, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001148 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001148 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001148 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127493 Rosetta Predictions human pricing
NM_001148 Rosetta Predictions human pricing
NM_020977 Rosetta Predictions human pricing
XM_001076082 Rosetta Predictions rat pricing
XM_342337 Rosetta Predictions rat pricing
NM_001034168 Rosetta Predictions mouse pricing
NM_178655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329674 predicted 4246
2 SASI_Hs02_00329675 predicted 761
3 SASI_Hs02_00329676 predicted 865
4 SASI_Hs02_00329677 predicted 2798
5 SASI_Hs02_00329678 predicted 615
6 SASI_Hs02_00329679 predicted 2327
7 SASI_Hs02_00329680 predicted 1534
8 SASI_Hs02_00329681 predicted 4092
9 SASI_Hs02_00329682 predicted 3921
10 SASI_Hs02_00329683 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163215 predicted 4152
2 SASI_Hs01_00163216 predicted 706
3 SASI_Hs01_00163217 predicted 810
4 SASI_Hs02_00331244 predicted 2741
5 SASI_Hs01_00163218 predicted 550
6 SASI_Hs01_00163219 predicted 2262
7 SASI_Hs01_00163221 predicted 1482
8 SASI_Hs01_00163223 predicted 3995
9 SASI_Hs02_00331245 predicted 3829
10 SASI_Hs02_00331246 predicted 1791
11 SASI_Hs01_00163220 predicted 3993
12 SASI_Hs01_00163222 predicted 2972
13 SASI_Hs01_00163224 predicted 3107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131565 predicted 4158
2 SASI_Hs01_00131566 predicted 710
3 SASI_Hs01_00131567 predicted 810
4 SASI_Hs02_00354419 predicted 2746
5 SASI_Hs01_00131568 predicted 559
6 SASI_Hs01_00131569 predicted 2264
7 SASI_Hs01_00131571 predicted 1479
8 SASI_Hs01_00131573 predicted 3994
9 SASI_Hs02_00354420 predicted 3827
10 SASI_Hs02_00354421 predicted 1797
11 SASI_Hs01_00131570 predicted 3991
12 SASI_Hs01_00131572 predicted 2968
13 SASI_Hs01_00131574 predicted 3107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351987 predicted 5097
2 SASI_Rn02_00351988 predicted 8177
3 SASI_Rn02_00351989 predicted 5168
4 SASI_Rn02_00351990 predicted 7161
5 SASI_Rn02_00351991 predicted 6620
6 SASI_Rn02_00351992 predicted 10847
7 SASI_Rn02_00351993 predicted 2772
8 SASI_Rn02_00351994 predicted 11780
9 SASI_Rn02_00351995 predicted 8244
10 SASI_Rn02_00351996 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394137 predicted 4449
2 SASI_Rn02_00394138 predicted 4611
3 SASI_Rn02_00394139 predicted 5537
4 SASI_Rn02_00394140 predicted 1970
5 SASI_Rn02_00394141 predicted 5245
6 SASI_Rn02_00394142 predicted 4058
7 SASI_Rn02_00394143 predicted 2729
8 SASI_Rn02_00394144 predicted 4953
9 SASI_Rn02_00394145 predicted 3526
10 SASI_Rn02_00394146 predicted 3245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040191 predicted 2860
2 SASI_Mm01_00040193 predicted 2367
3 SASI_Mm01_00040194 predicted 2500
4 SASI_Mm02_00289105 predicted 2595
5 SASI_Mm01_00040195 predicted 2977
6 SASI_Mm01_00040196 predicted 2865
7 SASI_Mm02_00289106 predicted 2743
8 SASI_Mm01_00040198 predicted 2245
9 SASI_Mm01_00040199 predicted 2226
10 SASI_Mm01_00040200 predicted 2005
11 SASI_Mm01_00040192 predicted 2918
12 SASI_Mm01_00040197 predicted 2806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105702 predicted 3159
2 SASI_Mm01_00105704 predicted 2674
3 SASI_Mm01_00105705 predicted 2807
4 SASI_Mm02_00349086 predicted 2898
5 SASI_Mm01_00105706 predicted 3284
6 SASI_Mm01_00105707 predicted 3175
7 SASI_Mm02_00349087 predicted 3045
8 SASI_Mm01_00105709 predicted 2546
9 SASI_Mm01_00105710 predicted 2530
10 SASI_Mm01_00105711 predicted 2308
11 SASI_Mm01_00105703 predicted 3222
12 SASI_Mm01_00105708 predicted 3117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178655
VALIDATED
ANK2 MISSION shRNA Bacterial Glycerol Stock
ankyrin 2, neuronal
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-726s21c1
Sequence:CCGGCATTATCCCACCTCGGAAATGCTCGAGCATTTCCGAGGTGGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-2538s21c1
Sequence:CCGGAGACATATCTGTCGGTTATTCCTCGAGGAATAACCGACAGATATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1615s21c1
Sequence:CCGGATTATCTGTGTGCCATATATGCTCGAGCATATATGGCACACAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1971s21c1
Sequence:CCGGACTGGTGCATCAAGCTATTTGCTCGAGCAAATAGCTTGATGCACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1257s1c1
Sequence:CCGGGCATAGTGAATTGGTAAAGAACTCGAGTTCTTTACCAATTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178655.2-2897s1c1
Sequence:CCGGGCCTGGTCATTGTTGAGTCAACTCGAGTTGACTCAACAATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1567s1c1
Sequence:CCGGCGACAGATTCAGGAGTCTGTTCTCGAGAACAGACTCCTGAATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178655.2-4424s1c1
Sequence:CCGGCCGGTGTTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-2733s1c1
Sequence:CCGGCGTTCCTGACTCTCTCTGTAACTCGAGTTACAGAGAGAGTCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178655
VALIDATED
ANK2 MISSION shRNA shRNA Plasmid DNA
ankyrin 2, neuronal
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-726s21c1
Sequence:CCGGCATTATCCCACCTCGGAAATGCTCGAGCATTTCCGAGGTGGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-2538s21c1
Sequence:CCGGAGACATATCTGTCGGTTATTCCTCGAGGAATAACCGACAGATATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1615s21c1
Sequence:CCGGATTATCTGTGTGCCATATATGCTCGAGCATATATGGCACACAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1971s21c1
Sequence:CCGGACTGGTGCATCAAGCTATTTGCTCGAGCAAATAGCTTGATGCACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1257s1c1
Sequence:CCGGGCATAGTGAATTGGTAAAGAACTCGAGTTCTTTACCAATTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178655.2-2897s1c1
Sequence:CCGGGCCTGGTCATTGTTGAGTCAACTCGAGTTGACTCAACAATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1567s1c1
Sequence:CCGGCGACAGATTCAGGAGTCTGTTCTCGAGAACAGACTCCTGAATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178655.2-4424s1c1
Sequence:CCGGCCGGTGTTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-2733s1c1
Sequence:CCGGCGTTCCTGACTCTCTCTGTAACTCGAGTTACAGAGAGAGTCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178655
VALIDATED
ANK2 MISSION shRNA Lentiviral Transduction Particles
ankyrin 2, neuronal
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-726s21c1
Sequence:CCGGCATTATCCCACCTCGGAAATGCTCGAGCATTTCCGAGGTGGGATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-2538s21c1
Sequence:CCGGAGACATATCTGTCGGTTATTCCTCGAGGAATAACCGACAGATATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1615s21c1
Sequence:CCGGATTATCTGTGTGCCATATATGCTCGAGCATATATGGCACACAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178655.3-1971s21c1
Sequence:CCGGACTGGTGCATCAAGCTATTTGCTCGAGCAAATAGCTTGATGCACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1257s1c1
Sequence:CCGGGCATAGTGAATTGGTAAAGAACTCGAGTTCTTTACCAATTCACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178655.2-2897s1c1
Sequence:CCGGGCCTGGTCATTGTTGAGTCAACTCGAGTTGACTCAACAATGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-1567s1c1
Sequence:CCGGCGACAGATTCAGGAGTCTGTTCTCGAGAACAGACTCCTGAATCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178655.2-4424s1c1
Sequence:CCGGCCGGTGTTCATTGCTGCTTTACTCGAGTAAAGCAGCAATGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178655.2-2733s1c1
Sequence:CCGGCGTTCCTGACTCTCTCTGTAACTCGAGTTACAGAGAGAGTCAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001148
VALIDATED
ANK2 MISSION shRNA Bacterial Glycerol Stock
ankyrin 2, neuronal
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-6824s1c1
Sequence:CCGGCCACAGAAATTCGTTCAGAAACTCGAGTTTCTGAACGAATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-2193s1c1
Sequence:CCGGGCTTGGTTACACACCTTTAATCTCGAGATTAAAGGTGTGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-10162s1c1
Sequence:CCGGGCACCAGATAATAGAAGCAAACTCGAGTTTGCTTCTATTATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-11485s1c1
Sequence:CCGGCCCATCATACAAGAACCCGAACTCGAGTTCGGGTTCTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-613s1c1
Sequence:CCGGGCTAGGAAAGACGACACCAAACTCGAGTTTGGTGTCGTCTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001148
VALIDATED
ANK2 MISSION shRNA shRNA Plasmid DNA
ankyrin 2, neuronal
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-6824s1c1
Sequence:CCGGCCACAGAAATTCGTTCAGAAACTCGAGTTTCTGAACGAATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-2193s1c1
Sequence:CCGGGCTTGGTTACACACCTTTAATCTCGAGATTAAAGGTGTGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-10162s1c1
Sequence:CCGGGCACCAGATAATAGAAGCAAACTCGAGTTTGCTTCTATTATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-11485s1c1
Sequence:CCGGCCCATCATACAAGAACCCGAACTCGAGTTCGGGTTCTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-613s1c1
Sequence:CCGGGCTAGGAAAGACGACACCAAACTCGAGTTTGGTGTCGTCTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001148
VALIDATED
ANK2 MISSION shRNA Lentiviral Transduction Particles
ankyrin 2, neuronal
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-6824s1c1
Sequence:CCGGCCACAGAAATTCGTTCAGAAACTCGAGTTTCTGAACGAATTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-2193s1c1
Sequence:CCGGGCTTGGTTACACACCTTTAATCTCGAGATTAAAGGTGTGTAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-10162s1c1
Sequence:CCGGGCACCAGATAATAGAAGCAAACTCGAGTTTGCTTCTATTATCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001148.2-11485s1c1
Sequence:CCGGCCCATCATACAAGAACCCGAACTCGAGTTCGGGTTCTTGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001148.2-613s1c1
Sequence:CCGGGCTAGGAAAGACGACACCAAACTCGAGTTTGGTGTCGTCTTTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks