EMAIL THIS PAGE TO A FRIEND

ANK3

ankyrin 3, node of Ranvier (ankyrin G)

209 Gene Product Result for
Synonyms: ANKYRIN-G
Gene ID:
Human(288) Summary: Ankyrins are a family of proteins that are believed to link the integral membrane proteins to the underlying spectrin-actin cytoskeleton and play key roles in activities such as cell motility, activation, proliferation, contact, and the maintenance of specialized membrane domains. Multiple isoforms of ankyrin with different affinities for various target proteins are expressed in a tissue-specific, developmentally regulated manner. Most ankyrins are typically composed of three structural domains: an amino-terminal domain containing multiple ankyrin repeats; a central region with a highly conserved spectrin binding domain; and a carboxy-terminal regulatory domain which is the least conserved and subject to variation. Ankyrin 3 is an immunologically distinct gene product from ankyrins 1 and 2, and was originally found at the axonal initial segment and nodes of Ranvier of neurons in the central and peripheral nervous systems. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
Mouse(11735) ankyrin 3, epithelial
Rat(361833) ankyrin 3, node of Ranvier (ankyrin G)
chicken(396309) ankyrin 3, node of Ranvier (ankyrin G)
cow(511203) ankyrin 3, node of Ranvier (ankyrin G)
Horse(100062775) ankyrin 3, node of Ranvier (ankyrin G)
domestic cat(101097842) ankyrin 3, node of Ranvier (ankyrin G)
dog(479215) ankyrin 3, node of Ranvier (ankyrin G)
naked mole-rat(101719656) ankyrin 3, node of Ranvier (ankyrin G)
domestic guinea pig(100734552) ankyrin 3, node of Ranvier (ankyrin G)
sheep(101120296) ankyrin 3, node of Ranvier (ankyrin G)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055643 Anti-ANK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA038455 Anti-ANK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4301064 Anti-ANK3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB5200447 Monoclonal Anti-Ankyrin G - Alkaline Phosphatase antibody produced in mouse clone S106-20, purified immunoglobulin rat, mouse, human
western blot pricing
SAB5200448 Monoclonal Anti-Ankyrin G - Apc antibody produced in mouse clone S106-20, purified immunoglobulin rat, human, mouse
western blot pricing
SAB5200439 Monoclonal Anti-Ankyrin G - Atto 390 antibody produced in mouse clone S106-20, purified immunoglobulin mouse, human, rat
western blot pricing
SAB5200440 Monoclonal Anti-Ankyrin G - Atto 488 antibody produced in mouse clone S106-20, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200441 Monoclonal Anti-Ankyrin G - Atto 565 antibody produced in mouse clone S106-20, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200442 Monoclonal Anti-Ankyrin G - Atto 594 antibody produced in mouse clone S106-20, purified immunoglobulin human, mouse, rat
western blot pricing
SAB5200443 Monoclonal Anti-Ankyrin G - Atto 633 antibody produced in mouse clone S106-20, purified immunoglobulin mouse, human, rat
western blot pricing
SAB5200444 Monoclonal Anti-Ankyrin G - Atto 655 antibody produced in mouse clone S106-20, purified immunoglobulin mouse, rat, human
western blot pricing
SAB5200445 Monoclonal Anti-Ankyrin G - Atto 680 antibody produced in mouse clone S106-20, purified immunoglobulin human, mouse, rat
western blot pricing
SAB5200446 Monoclonal Anti-Ankyrin G - Atto 700 antibody produced in mouse clone S106-20, purified immunoglobulin mouse, rat, human
western blot pricing
SAB5200449 Monoclonal Anti-Ankyrin G - Biotin antibody produced in mouse clone S106-20, purified immunoglobulin rat, mouse, human
western blot pricing
SAB5200450 Monoclonal Anti-Ankyrin G - Fitc antibody produced in mouse clone S106-20, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200451 Monoclonal Anti-Ankyrin G - Hrp antibody produced in mouse clone S106-20, purified immunoglobulin mouse, rat, human
western blot pricing
SAB5200452 Monoclonal Anti-Ankyrin G - Pe/Atto 594 antibody produced in mouse clone S106-20, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200453 Monoclonal Anti-Ankyrin G - Percp antibody produced in mouse clone S106-20, purified immunoglobulin mouse, human, rat
western blot pricing
SAB5200454 Monoclonal Anti-Ankyrin G - Rpe antibody produced in mouse clone S106-20, purified immunoglobulin rat, mouse, human
western blot pricing
SAB5200455 Monoclonal Anti-Ankyrin G - Streptavidin antibody produced in mouse clone S106-20, purified immunoglobulin mouse, human, rat
western blot pricing
SAB5200438 Monoclonal Anti-Ankyrin G antibody produced in mouse clone S106-20, purified immunoglobulin mouse, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001149 Rosetta Predictions human pricing
NM_020987 Rosetta Predictions human pricing
NM_001033984 Rosetta Predictions rat pricing
NM_031805 Rosetta Predictions rat pricing
NM_009670 Rosetta Predictions mouse pricing
NM_146005 Rosetta Predictions mouse pricing
NM_170687 Rosetta Predictions mouse pricing
NM_170688 Rosetta Predictions mouse pricing
NM_170689 Rosetta Predictions mouse pricing
NM_170690 Rosetta Predictions mouse pricing
NM_170728 Rosetta Predictions mouse pricing
NM_170729 Rosetta Predictions mouse pricing
NM_170730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032609 predicted 1240
2 SASI_Hs01_00032610 predicted 1925
3 SASI_Hs02_00331247 predicted 858
4 SASI_Hs01_00032611 predicted 845
5 SASI_Hs01_00032612 predicted 1986
6 SASI_Hs01_00032613 predicted 1703
7 SASI_Hs01_00032614 predicted 1803
8 SASI_Hs01_00032615 predicted 926
9 SASI_Hs01_00032616 predicted 955
10 SASI_Hs01_00032617 predicted 1650
11 SASI_Hs01_00032618 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172936 predicted 3412
2 SASI_Hs01_00172937 predicted 4096
3 SASI_Hs02_00354439 predicted 3029
4 SASI_Hs01_00172938 predicted 3019
5 SASI_Hs01_00172939 predicted 4157
6 SASI_Hs01_00172940 predicted 3869
7 SASI_Hs01_00172941 predicted 3974
8 SASI_Hs01_00172942 predicted 3087
9 SASI_Hs01_00172943 predicted 3127
10 SASI_Hs01_00172944 predicted 3818
11 SASI_Hs01_00172945 predicted 4174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031058 predicted 1837
2 SASI_Rn01_00031060 predicted 1257
3 SASI_Rn01_00031061 predicted 2149
4 SASI_Rn01_00031062 predicted 4106
5 SASI_Rn01_00031063 predicted 4004
6 SASI_Rn01_00031064 predicted 1559
7 SASI_Rn01_00031065 predicted 1058
8 SASI_Rn01_00031066 predicted 1563
9 SASI_Rn02_00203863 predicted 1337
10 SASI_Rn01_00031067 predicted 1296
11 SASI_Rn01_00031059 predicted 3606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035211 predicted 2136
2 SASI_Rn01_00035213 predicted 1556
3 SASI_Rn01_00035214 predicted 2449
4 SASI_Rn01_00035215 predicted 4347
5 SASI_Rn01_00035216 predicted 4231
6 SASI_Rn01_00035217 predicted 1856
7 SASI_Rn01_00035218 predicted 1350
8 SASI_Rn01_00035219 predicted 1863
9 SASI_Rn02_00265261 predicted 1643
10 SASI_Rn01_00035220 predicted 1596
11 SASI_Rn01_00035212 predicted 3849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075524 predicted 1854
2 SASI_Mm01_00075526 predicted 2135
3 SASI_Mm01_00075527 predicted 1307
4 SASI_Mm01_00075528 predicted 2473
5 SASI_Mm01_00075529 predicted 1981
6 SASI_Mm01_00075531 predicted 2392
7 SASI_Mm02_00316707 predicted 2325
8 SASI_Mm02_00316708 predicted 3144
9 SASI_Mm02_00316709 predicted 1264
10 SASI_Mm02_00316710 predicted 3125
11 SASI_Mm01_00075523 predicted 971
12 SASI_Mm01_00075525 predicted 2678
13 SASI_Mm01_00075530 predicted 2661
14 SASI_Mm01_00075532 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031274 predicted 4324
2 SASI_Mm02_00341545 predicted 6059
3 SASI_Mm01_00031275 predicted 4605
4 SASI_Mm01_00031276 predicted 3784
5 SASI_Mm01_00031277 predicted 4944
6 SASI_Mm01_00031278 predicted 4452
7 SASI_Mm02_00341546 predicted 4863
8 SASI_Mm02_00341547 predicted 4791
9 SASI_Mm02_00341548 predicted 6202
10 SASI_Mm01_00031281 predicted 3735
11 SASI_Mm01_00031273 predicted 4535
12 SASI_Mm01_00031279 predicted 4117
13 SASI_Mm01_00031280 predicted 4031
14 SASI_Mm01_00031282 predicted 3915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343566 predicted 963
2 SASI_Mm01_00085712 predicted 1847
3 SASI_Mm02_00343567 predicted 2678
4 SASI_Mm01_00085713 predicted 2137
5 SASI_Mm01_00085714 predicted 1304
6 SASI_Mm01_00085715 predicted 2466
7 SASI_Mm01_00085716 predicted 1982
8 SASI_Mm02_00343568 predicted 2662
9 SASI_Mm02_00343569 predicted 2388
10 SASI_Mm02_00343570 predicted 851
11 SASI_Mm01_00085711 predicted 2458
12 SASI_Mm01_00085717 predicted 2051
13 SASI_Mm01_00085718 predicted 1960
14 SASI_Mm01_00085719 predicted 1277
15 SASI_Mm01_00085720 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110509 predicted 4319
2 SASI_Mm01_00110510 predicted 4608
3 SASI_Mm01_00110511 predicted 3779
4 SASI_Mm01_00110512 predicted 4939
5 SASI_Mm01_00110513 predicted 4451
6 SASI_Mm02_00343571 predicted 4858
7 SASI_Mm02_00343572 predicted 4790
8 SASI_Mm02_00343573 predicted 5622
9 SASI_Mm01_00110516 predicted 3733
10 SASI_Mm02_00343574 predicted 5593
11 SASI_Mm01_00110508 predicted 4527
12 SASI_Mm01_00110514 predicted 4120
13 SASI_Mm01_00110515 predicted 4030
14 SASI_Mm01_00110517 predicted 3906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059336 predicted 4267
2 SASI_Mm02_00343575 predicted 6000
3 SASI_Mm01_00059337 predicted 4554
4 SASI_Mm01_00059338 predicted 3725
5 SASI_Mm01_00059339 predicted 4887
6 SASI_Mm01_00059340 predicted 4397
7 SASI_Mm02_00343576 predicted 4800
8 SASI_Mm02_00343577 predicted 4737
9 SASI_Mm02_00343578 predicted 6151
10 SASI_Mm01_00059343 predicted 3684
11 SASI_Mm01_00059335 predicted 4481
12 SASI_Mm01_00059341 predicted 4061
13 SASI_Mm01_00059342 predicted 3972
14 SASI_Mm01_00059344 predicted 3855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184060 predicted 4262
2 SASI_Mm02_00343579 predicted 6000
3 SASI_Mm01_00184061 predicted 4538
4 SASI_Mm01_00184062 predicted 3719
5 SASI_Mm01_00184063 predicted 4879
6 SASI_Mm01_00184064 predicted 4385
7 SASI_Mm02_00343580 predicted 4797
8 SASI_Mm02_00343581 predicted 4734
9 SASI_Mm02_00343582 predicted 6138
10 SASI_Mm01_00184067 predicted 3676
11 SASI_Mm01_00184059 predicted 4471
12 SASI_Mm01_00184065 predicted 4052
13 SASI_Mm01_00184066 predicted 3970
14 SASI_Mm01_00184068 predicted 3853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177685 predicted 4210
2 SASI_Mm01_00177686 predicted 4488
3 SASI_Mm01_00177687 predicted 3662
4 SASI_Mm01_00177688 predicted 4829
5 SASI_Mm01_00177689 predicted 4337
6 SASI_Mm02_00343586 predicted 4745
7 SASI_Mm02_00343587 predicted 4681
8 SASI_Mm02_00343588 predicted 5503
9 SASI_Mm01_00177692 predicted 3625
10 SASI_Mm02_00343589 predicted 5479
11 SASI_Mm01_00177684 predicted 4686
12 SASI_Mm01_00177690 predicted 4272
13 SASI_Mm01_00177691 predicted 4184
14 SASI_Mm01_00177693 predicted 4069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122003 predicted 4203
2 SASI_Mm02_00343590 predicted 5940
3 SASI_Mm01_00122004 predicted 4482
4 SASI_Mm01_00122005 predicted 3666
5 SASI_Mm01_00122006 predicted 4824
6 SASI_Mm01_00122007 predicted 4330
7 SASI_Mm02_00343591 predicted 4744
8 SASI_Mm02_00343592 predicted 4680
9 SASI_Mm02_00343593 predicted 6088
10 SASI_Mm01_00122010 predicted 3616
11 SASI_Mm01_00122002 predicted 2083
12 SASI_Mm01_00122008 predicted 1667
13 SASI_Mm01_00122009 predicted 1581
14 SASI_Mm01_00122011 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139328 predicted 1544
2 SASI_Mm01_00139329 predicted 1825
3 SASI_Mm01_00139330 predicted 994
4 SASI_Mm01_00139331 predicted 2164
5 SASI_Mm01_00139332 predicted 1669
6 SASI_Mm02_00343594 predicted 2076
7 SASI_Mm02_00343595 predicted 2012
8 SASI_Mm02_00343596 predicted 2834
9 SASI_Mm01_00139335 predicted 953
10 SASI_Mm02_00343597 predicted 2812
11 SASI_Mm01_00139327 predicted 1648
12 SASI_Mm01_00139333 predicted 1233
13 SASI_Mm01_00139334 predicted 1151
14 SASI_Mm01_00139336 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170730
VALIDATED
ANK3 MISSION shRNA Bacterial Glycerol Stock
ankyrin 3, node of Ranvier (ankyrin G)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2130s1c1
Sequence:CCGGCCTGGGAAGATCGAAGCAAATCTCGAGATTTGCTTCGATCTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-48s1c1
Sequence:CCGGCCTGCTCATAGGAAGAGGAAACTCGAGTTTCCTCTTCCTATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2304s1c1
Sequence:CCGGGCCTACCAGAAATCTCTGGAACTCGAGTTCCAGAGATTTCTGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-1843s1c1
Sequence:CCGGCCACAACTGATGCCTTAACTTCTCGAGAAGTTAAGGCATCAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-302s1c1
Sequence:CCGGCCGCCTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-1138s21c1
Sequence:CCGGTGCCGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-632s21c1
Sequence:CCGGGCAGCGGACACGTTAGATAATCTCGAGATTATCTAACGTGTCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-4543s21c1
Sequence:CCGGCGGATAAGCTAGTCGATTATTCTCGAGAATAATCGACTAGCTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2362s21c1
Sequence:CCGGTTCGGTCTTAACGAAGATTAACTCGAGTTAATCTTCGTTAAGACCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2035s21c1
Sequence:CCGGTATTACTCTGCCGGCACATAACTCGAGTTATGTGCCGGCAGAGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170730
VALIDATED
ANK3 MISSION shRNA shRNA Plasmid DNA
ankyrin 3, node of Ranvier (ankyrin G)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2130s1c1
Sequence:CCGGCCTGGGAAGATCGAAGCAAATCTCGAGATTTGCTTCGATCTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-48s1c1
Sequence:CCGGCCTGCTCATAGGAAGAGGAAACTCGAGTTTCCTCTTCCTATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2304s1c1
Sequence:CCGGGCCTACCAGAAATCTCTGGAACTCGAGTTCCAGAGATTTCTGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-1843s1c1
Sequence:CCGGCCACAACTGATGCCTTAACTTCTCGAGAAGTTAAGGCATCAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-302s1c1
Sequence:CCGGCCGCCTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-1138s21c1
Sequence:CCGGTGCCGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-632s21c1
Sequence:CCGGGCAGCGGACACGTTAGATAATCTCGAGATTATCTAACGTGTCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-4543s21c1
Sequence:CCGGCGGATAAGCTAGTCGATTATTCTCGAGAATAATCGACTAGCTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2362s21c1
Sequence:CCGGTTCGGTCTTAACGAAGATTAACTCGAGTTAATCTTCGTTAAGACCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2035s21c1
Sequence:CCGGTATTACTCTGCCGGCACATAACTCGAGTTATGTGCCGGCAGAGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170730
VALIDATED
ANK3 MISSION shRNA Lentiviral Transduction Particles
ankyrin 3, node of Ranvier (ankyrin G)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2130s1c1
Sequence:CCGGCCTGGGAAGATCGAAGCAAATCTCGAGATTTGCTTCGATCTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-48s1c1
Sequence:CCGGCCTGCTCATAGGAAGAGGAAACTCGAGTTTCCTCTTCCTATGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-2304s1c1
Sequence:CCGGGCCTACCAGAAATCTCTGGAACTCGAGTTCCAGAGATTTCTGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-1843s1c1
Sequence:CCGGCCACAACTGATGCCTTAACTTCTCGAGAAGTTAAGGCATCAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170730.1-302s1c1
Sequence:CCGGCCGCCTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-1138s21c1
Sequence:CCGGTGCCGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-632s21c1
Sequence:CCGGGCAGCGGACACGTTAGATAATCTCGAGATTATCTAACGTGTCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-4543s21c1
Sequence:CCGGCGGATAAGCTAGTCGATTATTCTCGAGAATAATCGACTAGCTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2362s21c1
Sequence:CCGGTTCGGTCTTAACGAAGATTAACTCGAGTTAATCTTCGTTAAGACCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170730.2-2035s21c1
Sequence:CCGGTATTACTCTGCCGGCACATAACTCGAGTTATGTGCCGGCAGAGTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001149
VALIDATED
ANK3 MISSION shRNA Bacterial Glycerol Stock
ankyrin 3, node of Ranvier (ankyrin G)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-4863s1c1
Sequence:CCGGGCAGTGTCATATTAGGTTAATCTCGAGATTAACCTAATATGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1088s1c1
Sequence:CCGGGCCGTTTGGTAAAGAGACATACTCGAGTATGTCTCTTTACCAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1991s1c1
Sequence:CCGGCCGTAGAATCTTCCTTGCGATCTCGAGATCGCAAGGAAGATTCTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001149.2-3394s1c1
Sequence:CCGGGCAGCATATCAGAAATCTCTACTCGAGTAGAGATTTCTGATATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1089s1c1
Sequence:CCGGCCGTTTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-2689s21c1
Sequence:CCGGCTGCTAGAAGGACCAATATTTCTCGAGAAATATTGGTCCTTCTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-3634s21c1
Sequence:CCGGACGGTCAGTCAAGGATCATAACTCGAGTTATGATCCTTGACTGACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1810s21c1
Sequence:CCGGACAACTCCTTTGACGTTTATACTCGAGTATAAACGTCAAAGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-1031s21c1
Sequence:CCGGACGGGATGAGAATCATCATTCCTCGAGGAATGATGATTCTCATCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1425s21c1
Sequence:CCGGTGCAGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001149
VALIDATED
ANK3 MISSION shRNA shRNA Plasmid DNA
ankyrin 3, node of Ranvier (ankyrin G)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-4863s1c1
Sequence:CCGGGCAGTGTCATATTAGGTTAATCTCGAGATTAACCTAATATGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1088s1c1
Sequence:CCGGGCCGTTTGGTAAAGAGACATACTCGAGTATGTCTCTTTACCAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1991s1c1
Sequence:CCGGCCGTAGAATCTTCCTTGCGATCTCGAGATCGCAAGGAAGATTCTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001149.2-3394s1c1
Sequence:CCGGGCAGCATATCAGAAATCTCTACTCGAGTAGAGATTTCTGATATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1089s1c1
Sequence:CCGGCCGTTTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-2689s21c1
Sequence:CCGGCTGCTAGAAGGACCAATATTTCTCGAGAAATATTGGTCCTTCTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-3634s21c1
Sequence:CCGGACGGTCAGTCAAGGATCATAACTCGAGTTATGATCCTTGACTGACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1810s21c1
Sequence:CCGGACAACTCCTTTGACGTTTATACTCGAGTATAAACGTCAAAGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-1031s21c1
Sequence:CCGGACGGGATGAGAATCATCATTCCTCGAGGAATGATGATTCTCATCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1425s21c1
Sequence:CCGGTGCAGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001149
VALIDATED
ANK3 MISSION shRNA Lentiviral Transduction Particles
ankyrin 3, node of Ranvier (ankyrin G)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116332    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-4863s1c1
Sequence:CCGGGCAGTGTCATATTAGGTTAATCTCGAGATTAACCTAATATGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1088s1c1
Sequence:CCGGGCCGTTTGGTAAAGAGACATACTCGAGTATGTCTCTTTACCAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1991s1c1
Sequence:CCGGCCGTAGAATCTTCCTTGCGATCTCGAGATCGCAAGGAAGATTCTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001149.2-3394s1c1
Sequence:CCGGGCAGCATATCAGAAATCTCTACTCGAGTAGAGATTTCTGATATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001149.2-1089s1c1
Sequence:CCGGCCGTTTGGTAAAGAGACATAACTCGAGTTATGTCTCTTTACCAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-2689s21c1
Sequence:CCGGCTGCTAGAAGGACCAATATTTCTCGAGAAATATTGGTCCTTCTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271426    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-3634s21c1
Sequence:CCGGACGGTCAGTCAAGGATCATAACTCGAGTTATGATCCTTGACTGACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1810s21c1
Sequence:CCGGACAACTCCTTTGACGTTTATACTCGAGTATAAACGTCAAAGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001149.2-1031s21c1
Sequence:CCGGACGGGATGAGAATCATCATTCCTCGAGGAATGATGATTCTCATCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001149.2-1425s21c1
Sequence:CCGGTGCAGTGGTTTCCCGGATTAACTCGAGTTAATCCGGGAAACCACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)