EMAIL THIS PAGE TO A FRIEND

ANKAR

ankyrin and armadillo repeat containing

53 Gene Product Result for
UniProtKB ID: Q7Z5J8, Q3ZCS6, Q4G0M2, Q6ZU02
Gene ID:
Mouse(319695) ankyrin and armadillo repeat containing
Rat(501138) ankyrin and armadillo repeat containing
Zebrafish(368636) ankyrin and armadillo repeat containing
domestic cat(101101326) ankyrin and armadillo repeat containing
cow(100140244) ankyrin and armadillo repeat containing
Horse(100069288) ankyrin and armadillo repeat containing
dog(488444) ankyrin and armadillo repeat containing
sheep(101113304) ankyrin and armadillo repeat containing
Domestic Rabbit(100341263) ankyrin and armadillo repeat containing
domestic guinea pig(100726347) ankyrin and armadillo repeat containing
naked mole-rat(101714186) ankyrin and armadillo repeat containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036168 Anti-ANKAR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144708 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083481 MISSION® esiRNA esiRNA human ANKAR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144708 Rosetta Predictions human pricing
XM_001062620 Rosetta Predictions rat pricing
XM_576558 Rosetta Predictions rat pricing
NM_176980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134290 predicted 3682
2 SASI_Hs01_00134291 predicted 844
3 SASI_Hs01_00134292 predicted 2676
4 SASI_Hs02_00364645 predicted 3367
5 SASI_Hs01_00134294 predicted 895
6 SASI_Hs01_00134295 predicted 1160
7 SASI_Hs01_00134296 predicted 2328
8 SASI_Hs01_00134297 predicted 1596
9 SASI_Hs02_00364646 predicted 252
10 SASI_Hs02_00364647 predicted 3108
11 SASI_Hs01_00134293 predicted 375
12 SASI_Hs01_00134298 predicted 3545
13 SASI_Hs01_00134299 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304019 predicted 3008
2 SASI_Rn02_00304020 predicted 1809
3 SASI_Rn02_00304021 predicted 3306
4 SASI_Rn02_00304022 predicted 2431
5 SASI_Rn02_00304023 predicted 269
6 SASI_Rn02_00304024 predicted 2337
7 SASI_Rn02_00304025 predicted 3934
8 SASI_Rn02_00304026 predicted 653
9 SASI_Rn02_00304027 predicted 3301
10 SASI_Rn02_00304028 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405540 predicted 1813
2 SASI_Rn02_00405541 predicted 2433
3 SASI_Rn02_00405542 predicted 267
4 SASI_Rn02_00405543 predicted 2337
5 SASI_Rn02_00405544 predicted 648
6 SASI_Rn02_00405545 predicted 2162
7 SASI_Rn02_00405546 predicted 1490
8 SASI_Rn02_00405547 predicted 2049
9 SASI_Rn02_00405548 predicted 435
10 SASI_Rn02_00405549 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176107 predicted 2308
2 SASI_Mm01_00176108 predicted 3758
3 SASI_Mm01_00176109 predicted 592
4 SASI_Mm01_00176110 predicted 2575
5 SASI_Mm01_00176111 predicted 2406
6 SASI_Mm02_00346899 predicted 3730
7 SASI_Mm01_00176112 predicted 4195
8 SASI_Mm01_00176113 predicted 3158
9 SASI_Mm01_00176114 predicted 530
10 SASI_Mm01_00176115 predicted 2371
11 SASI_Mm01_00176116 predicted 3055
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176980
ANKAR MISSION shRNA Bacterial Glycerol Stock
ankyrin and armadillo repeat containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-3761s21c1
Sequence:CCGGGCATTTCAGATCATCATATTACTCGAGTAATATGATGATCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-4338s21c1
Sequence:CCGGCAACACACAAGGCCAATATTTCTCGAGAAATATTGGCCTTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-1579s21c1
Sequence:CCGGTCAACTACATGAGCAATTTAACTCGAGTTAAATTGCTCATGTAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-774s1c1
Sequence:CCGGCCAGACTTTAATGGGATCTATCTCGAGATAGATCCCATTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-3789s1c1
Sequence:CCGGGCCATTATTGATGTGGAACATCTCGAGATGTTCCACATCAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-1221s1c1
Sequence:CCGGCCATTTATTTATGGACGAGATCTCGAGATCTCGTCCATAAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2421s1c1
Sequence:CCGGCCTGCCTTAGTCAATCTATTACTCGAGTAATAGATTGACTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2730s1c1
Sequence:CCGGCGGGTGTTATGTATGGGAAATCTCGAGATTTCCCATACATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176980
ANKAR MISSION shRNA shRNA Plasmid DNA
ankyrin and armadillo repeat containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-3761s21c1
Sequence:CCGGGCATTTCAGATCATCATATTACTCGAGTAATATGATGATCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-4338s21c1
Sequence:CCGGCAACACACAAGGCCAATATTTCTCGAGAAATATTGGCCTTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-1579s21c1
Sequence:CCGGTCAACTACATGAGCAATTTAACTCGAGTTAAATTGCTCATGTAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-774s1c1
Sequence:CCGGCCAGACTTTAATGGGATCTATCTCGAGATAGATCCCATTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-3789s1c1
Sequence:CCGGGCCATTATTGATGTGGAACATCTCGAGATGTTCCACATCAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-1221s1c1
Sequence:CCGGCCATTTATTTATGGACGAGATCTCGAGATCTCGTCCATAAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2421s1c1
Sequence:CCGGCCTGCCTTAGTCAATCTATTACTCGAGTAATAGATTGACTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2730s1c1
Sequence:CCGGCGGGTGTTATGTATGGGAAATCTCGAGATTTCCCATACATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176980
ANKAR MISSION shRNA Lentiviral Transduction Particles
ankyrin and armadillo repeat containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-3761s21c1
Sequence:CCGGGCATTTCAGATCATCATATTACTCGAGTAATATGATGATCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-4338s21c1
Sequence:CCGGCAACACACAAGGCCAATATTTCTCGAGAAATATTGGCCTTGTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176980.4-1579s21c1
Sequence:CCGGTCAACTACATGAGCAATTTAACTCGAGTTAAATTGCTCATGTAGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-774s1c1
Sequence:CCGGCCAGACTTTAATGGGATCTATCTCGAGATAGATCCCATTAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-3789s1c1
Sequence:CCGGGCCATTATTGATGTGGAACATCTCGAGATGTTCCACATCAATAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-1221s1c1
Sequence:CCGGCCATTTATTTATGGACGAGATCTCGAGATCTCGTCCATAAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2421s1c1
Sequence:CCGGCCTGCCTTAGTCAATCTATTACTCGAGTAATAGATTGACTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176980.2-2730s1c1
Sequence:CCGGCGGGTGTTATGTATGGGAAATCTCGAGATTTCCCATACATAACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144708
ANKAR MISSION shRNA Bacterial Glycerol Stock
ankyrin and armadillo repeat containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3065s21c1
Sequence:CCGGATCACCCTTCTCCTAACATTACTCGAGTAATGTTAGGAGAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3686s21c1
Sequence:CCGGCTAATCAGTTCATTCGTATAACTCGAGTTATACGAATGAACTGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-184s21c1
Sequence:CCGGCAATTACCTCCAGCTTATTATCTCGAGATAATAAGCTGGAGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-59s21c1
Sequence:CCGGCTACTGCCCTCTTAGACTATACTCGAGTATAGTCTAAGAGGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3392s21c1
Sequence:CCGGTTAGAGATATGGACCATATTACTCGAGTAATATGGTCCATATCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144708
ANKAR MISSION shRNA shRNA Plasmid DNA
ankyrin and armadillo repeat containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3065s21c1
Sequence:CCGGATCACCCTTCTCCTAACATTACTCGAGTAATGTTAGGAGAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3686s21c1
Sequence:CCGGCTAATCAGTTCATTCGTATAACTCGAGTTATACGAATGAACTGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-184s21c1
Sequence:CCGGCAATTACCTCCAGCTTATTATCTCGAGATAATAAGCTGGAGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-59s21c1
Sequence:CCGGCTACTGCCCTCTTAGACTATACTCGAGTATAGTCTAAGAGGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3392s21c1
Sequence:CCGGTTAGAGATATGGACCATATTACTCGAGTAATATGGTCCATATCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144708
ANKAR MISSION shRNA Lentiviral Transduction Particles
ankyrin and armadillo repeat containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3065s21c1
Sequence:CCGGATCACCCTTCTCCTAACATTACTCGAGTAATGTTAGGAGAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3686s21c1
Sequence:CCGGCTAATCAGTTCATTCGTATAACTCGAGTTATACGAATGAACTGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-184s21c1
Sequence:CCGGCAATTACCTCCAGCTTATTATCTCGAGATAATAAGCTGGAGGTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-59s21c1
Sequence:CCGGCTACTGCCCTCTTAGACTATACTCGAGTATAGTCTAAGAGGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144708.2-3392s21c1
Sequence:CCGGTTAGAGATATGGACCATATTACTCGAGTAATATGGTCCATATCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks