EMAIL THIS PAGE TO A FRIEND

ANKDD1A

ankyrin repeat and death domain containing 1A

UniProtKB ID: Q495B1, Q495B2, Q495B3, Q8N7A0, Q8NBS5
Gene ID:
Mouse(384945) ankyrin repeat and death domain containing 1A
Rat(100362785) ankyrin repeat and death domain containing 1A
naked mole-rat(101714082) ankyrin repeat and death domain containing 1A
Domestic Rabbit(100351090) ankyrin repeat and death domain containing 1A
Zebrafish(569271) ankyrin repeat and death domain containing 1A
Horse(100066607) ankyrin repeat and death domain containing 1A
domestic cat(101097244) ankyrin repeat and death domain containing 1A
dog(487598) ankyrin repeat and death domain containing 1A
chicken(415525) ankyrin repeat and death domain containing 1A
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182703 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087921 MISSION® esiRNA esiRNA human ANKDD1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182703 Rosetta Predictions human pricing
XM_357954 Rosetta Predictions mouse pricing
XM_917864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162467 predicted 1980
2 SASI_Hs02_00370868 predicted 1081
3 SASI_Hs01_00162468 predicted 385
4 SASI_Hs01_00162471 predicted 873
5 SASI_Hs01_00162473 predicted 342
6 SASI_Hs01_00162474 predicted 319
7 SASI_Hs01_00162475 predicted 1951
8 SASI_Hs01_00162476 predicted 438
9 SASI_Hs02_00370869 predicted 387
10 SASI_Hs02_00370870 predicted 296
11 SASI_Hs01_00162469 predicted 1904
12 SASI_Hs01_00162470 predicted 773
13 SASI_Hs01_00162472 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252565 predicted 613
2 SASI_Mm01_00252566 predicted 224
3 SASI_Mm02_00426231 predicted 1163
4 SASI_Mm01_00252567 predicted 442
5 SASI_Mm01_00252568 predicted 1001
6 SASI_Mm01_00252569 predicted 781
7 SASI_Mm01_00252570 predicted 1047
8 SASI_Mm01_00252571 predicted 1162
9 SASI_Mm01_00252573 predicted 389
10 SASI_Mm01_00252574 predicted 267
11 SASI_Mm01_00252572 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441484 predicted 610
2 SASI_Mm02_00441485 predicted 231
3 SASI_Mm02_00441486 predicted 1167
4 SASI_Mm02_00441487 predicted 441
5 SASI_Mm02_00441488 predicted 997
6 SASI_Mm02_00441489 predicted 776
7 SASI_Mm02_00441490 predicted 1047
8 SASI_Mm02_00441491 predicted 1164
9 SASI_Mm02_00441492 predicted 390
10 SASI_Mm02_00441493 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182703
ANKDD1A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and death domain containing 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-40s1c1
Sequence:CCGGCGAATCCTCCAGATCTTGGTACTCGAGTACCAAGATCTGGAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-33s1c1
Sequence:CCGGCCACTTACGAATCCTCCAGATCTCGAGATCTGGAGGATTCGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-72s1c1
Sequence:CCGGCAAGATCCACTGTGAGAGCAACTCGAGTTGCTCTCACAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-46s1c1
Sequence:CCGGCTCCAGATCTTGGTAAACTCACTCGAGTGAGTTTACCAAGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-745s1c1
Sequence:CCGGGCAGATATGCTCCTCATTGCTCTCGAGAGCAATGAGGAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182703.2-2403s1c1
Sequence:CCGGCGTTTGCTCTAATGTGAGCTACTCGAGTAGCTCACATTAGAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-741s1c1
Sequence:CCGGCATAGCAGATATGCTCCTCATCTCGAGATGAGGAGCATATCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182703.3-129s21c1
Sequence:CCGGCTGATTGGGAGGAGGGTTAACCTCGAGGTTAACCCTCCTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182703.3-2065s21c1
Sequence:CCGGGTGTCTGCTTCTATTGCATATCTCGAGATATGCAATAGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182703
ANKDD1A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and death domain containing 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-40s1c1
Sequence:CCGGCGAATCCTCCAGATCTTGGTACTCGAGTACCAAGATCTGGAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-33s1c1
Sequence:CCGGCCACTTACGAATCCTCCAGATCTCGAGATCTGGAGGATTCGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-72s1c1
Sequence:CCGGCAAGATCCACTGTGAGAGCAACTCGAGTTGCTCTCACAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-46s1c1
Sequence:CCGGCTCCAGATCTTGGTAAACTCACTCGAGTGAGTTTACCAAGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-745s1c1
Sequence:CCGGGCAGATATGCTCCTCATTGCTCTCGAGAGCAATGAGGAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182703.2-2403s1c1
Sequence:CCGGCGTTTGCTCTAATGTGAGCTACTCGAGTAGCTCACATTAGAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-741s1c1
Sequence:CCGGCATAGCAGATATGCTCCTCATCTCGAGATGAGGAGCATATCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182703.3-129s21c1
Sequence:CCGGCTGATTGGGAGGAGGGTTAACCTCGAGGTTAACCCTCCTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182703.3-2065s21c1
Sequence:CCGGGTGTCTGCTTCTATTGCATATCTCGAGATATGCAATAGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182703
ANKDD1A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and death domain containing 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-40s1c1
Sequence:CCGGCGAATCCTCCAGATCTTGGTACTCGAGTACCAAGATCTGGAGGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-33s1c1
Sequence:CCGGCCACTTACGAATCCTCCAGATCTCGAGATCTGGAGGATTCGTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-72s1c1
Sequence:CCGGCAAGATCCACTGTGAGAGCAACTCGAGTTGCTCTCACAGTGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-46s1c1
Sequence:CCGGCTCCAGATCTTGGTAAACTCACTCGAGTGAGTTTACCAAGATCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-745s1c1
Sequence:CCGGGCAGATATGCTCCTCATTGCTCTCGAGAGCAATGAGGAGCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168161    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182703.2-2403s1c1
Sequence:CCGGCGTTTGCTCTAATGTGAGCTACTCGAGTAGCTCACATTAGAGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182703.2-741s1c1
Sequence:CCGGCATAGCAGATATGCTCCTCATCTCGAGATGAGGAGCATATCTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182703.3-129s21c1
Sequence:CCGGCTGATTGGGAGGAGGGTTAACCTCGAGGTTAACCCTCCTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182703.3-2065s21c1
Sequence:CCGGGTGTCTGCTTCTATTGCATATCTCGAGATATGCAATAGAAGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks