EMAIL THIS PAGE TO A FRIEND

ANKDD1B

ankyrin repeat and death domain containing 1B

47 Gene Product Result for
UniProtKB ID: A6NHY2
Gene ID:
Mouse(271144) ankyrin repeat and death domain containing 1B
Rat(100359662) ankyrin repeat and death domain containing 1B
Zebrafish(562681) ankyrin repeat and death domain containing 1B
cow(100849013) ankyrin repeat and death domain containing 1B
chicken(431596) ankyrin repeat and death domain containing 1B
Horse(100073282) ankyrin repeat and death domain containing 1B
domestic cat(101099859) ankyrin repeat and death domain containing 1B
Domestic Rabbit(100351967) ankyrin repeat and death domain containing 1B
domestic guinea pig(100726788) ankyrin repeat and death domain containing 1B
naked mole-rat(101718228) ankyrin repeat and death domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188191 MISSION® esiRNA esiRNA targeting mouse Ankdd1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001128459 Rosetta Predictions human pricing
XM_001714483 Rosetta Predictions human pricing
XM_001715633 Rosetta Predictions human pricing
NM_001042714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001128459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384961 predicted 575
2 SASI_Hs02_00384962 predicted 1519
3 SASI_Hs02_00384963 predicted 961
4 SASI_Hs02_00384964 predicted 1444
5 SASI_Hs02_00384965 predicted 809
6 SASI_Hs02_00384966 predicted 1104
7 SASI_Hs02_00384967 predicted 831
8 SASI_Hs02_00384968 predicted 1300
9 SASI_Hs02_00384969 predicted 1824
10 SASI_Hs02_00384970 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397416 predicted 1365
2 SASI_Hs02_00397417 predicted 1284
3 SASI_Hs02_00397418 predicted 529
4 SASI_Hs02_00397419 predicted 965
5 SASI_Hs02_00397420 predicted 1442
6 SASI_Hs02_00397421 predicted 810
7 SASI_Hs02_00397422 predicted 832
8 SASI_Hs02_00397423 predicted 1052
9 SASI_Hs02_00397424 predicted 1302
10 SASI_Hs02_00397425 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405037 predicted 1370
2 SASI_Hs02_00405038 predicted 1279
3 SASI_Hs02_00405039 predicted 529
4 SASI_Hs02_00405040 predicted 965
5 SASI_Hs02_00405041 predicted 1446
6 SASI_Hs02_00405042 predicted 816
7 SASI_Hs02_00405043 predicted 832
8 SASI_Hs02_00405044 predicted 1058
9 SASI_Hs02_00405045 predicted 1298
10 SASI_Hs02_00405046 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291025 predicted 1623
2 SASI_Mm02_00291026 predicted 674
3 SASI_Mm02_00291027 predicted 975
4 SASI_Mm02_00291028 predicted 1611
5 SASI_Mm02_00291029 predicted 464
6 SASI_Mm02_00291030 predicted 259
7 SASI_Mm02_00291031 predicted 740
8 SASI_Mm02_00291032 predicted 438
9 SASI_Mm02_00291033 predicted 806
10 SASI_Mm02_00291034 predicted 1590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042714
ANKDD1B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and death domain containing 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-368s21c1
Sequence:CCGGGATCATGCTCATGCTAGTTAACTCGAGTTAACTAGCATGAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-968s21c1
Sequence:CCGGAGTCGTGAACAGCTTACTAAGCTCGAGCTTAGTAAGCTGTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-671s21c1
Sequence:CCGGAGCCGTGCAAGTGCTACTAACCTCGAGGTTAGTAGCACTTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-1168s21c1
Sequence:CCGGTCGTGGATATGCTGATCAAAGCTCGAGCTTTGATCAGCATATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042714.1-2140s21c1
Sequence:CCGGCACAAGTGTAATCTATTATTCCTCGAGGAATAATAGATTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042714
ANKDD1B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and death domain containing 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-368s21c1
Sequence:CCGGGATCATGCTCATGCTAGTTAACTCGAGTTAACTAGCATGAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-968s21c1
Sequence:CCGGAGTCGTGAACAGCTTACTAAGCTCGAGCTTAGTAAGCTGTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-671s21c1
Sequence:CCGGAGCCGTGCAAGTGCTACTAACCTCGAGGTTAGTAGCACTTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-1168s21c1
Sequence:CCGGTCGTGGATATGCTGATCAAAGCTCGAGCTTTGATCAGCATATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042714.1-2140s21c1
Sequence:CCGGCACAAGTGTAATCTATTATTCCTCGAGGAATAATAGATTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042714
ANKDD1B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and death domain containing 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-368s21c1
Sequence:CCGGGATCATGCTCATGCTAGTTAACTCGAGTTAACTAGCATGAGCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-968s21c1
Sequence:CCGGAGTCGTGAACAGCTTACTAAGCTCGAGCTTAGTAAGCTGTTCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-671s21c1
Sequence:CCGGAGCCGTGCAAGTGCTACTAACCTCGAGGTTAGTAGCACTTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042714.1-1168s21c1
Sequence:CCGGTCGTGGATATGCTGATCAAAGCTCGAGCTTTGATCAGCATATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042714.1-2140s21c1
Sequence:CCGGCACAAGTGTAATCTATTATTCCTCGAGGAATAATAGATTACACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks