EMAIL THIS PAGE TO A FRIEND

ANKEF1

ankyrin repeat and EF-hand domain containing 1

76 Gene Product Result for
Synonyms: ANKRD5 dJ839B4.6
UniProtKB ID: Q9NU02, B3KUQ0, Q9H6Y9
Gene ID:
Mouse(319196) ankyrin repeat and EF-hand domain containing 1
Rat(296184) ankyrin repeat and EF-hand domain containing 1
naked mole-rat(101698426) ankyrin repeat and EF-hand domain containing 1
domestic guinea pig(100726142) ankyrin repeat and EF-hand domain containing 1
cow(788870) ankyrin repeat and EF-hand domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022096 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038061 MISSION® esiRNA esiRNA human ANKRD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022096 Rosetta Predictions human pricing
NM_198798 Rosetta Predictions human pricing
NM_001106516 Rosetta Predictions rat pricing
NM_175667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194953 predicted 949
2 SASI_Hs01_00194954 predicted 829
3 SASI_Hs01_00194955 predicted 1935
4 SASI_Hs01_00194956 predicted 2231
5 SASI_Hs02_00355483 predicted 2037
6 SASI_Hs01_00194957 predicted 1920
7 SASI_Hs02_00355484 predicted 704
8 SASI_Hs01_00194958 predicted 783
9 SASI_Hs01_00194959 predicted 2219
10 SASI_Hs01_00194962 predicted 839
11 SASI_Hs01_00194960 predicted 2114
12 SASI_Hs01_00194961 predicted 2389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188211 predicted 883
2 SASI_Hs01_00188212 predicted 758
3 SASI_Hs01_00188214 predicted 1869
4 SASI_Hs02_00372327 predicted 2165
5 SASI_Hs02_00372328 predicted 1966
6 SASI_Hs01_00188215 predicted 1853
7 SASI_Hs02_00372329 predicted 643
8 SASI_Hs01_00188216 predicted 723
9 SASI_Hs01_00188217 predicted 2156
10 SASI_Hs01_00188220 predicted 769
11 SASI_Hs01_00188213 predicted 2236
12 SASI_Hs01_00188218 predicted 2043
13 SASI_Hs01_00188219 predicted 2319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219728 predicted 2286
2 SASI_Rn02_00219729 predicted 2723
3 SASI_Rn02_00219730 predicted 492
4 SASI_Rn02_00219731 predicted 2097
5 SASI_Rn02_00219732 predicted 2804
6 SASI_Rn02_00219733 predicted 599
7 SASI_Rn02_00219734 predicted 1840
8 SASI_Rn02_00219735 predicted 1674
9 SASI_Rn02_00219736 predicted 636
10 SASI_Rn02_00219737 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128776 predicted 678
2 SASI_Mm01_00128777 predicted 2262
3 SASI_Mm01_00128778 predicted 750
4 SASI_Mm01_00128779 predicted 2477
5 SASI_Mm01_00128780 predicted 2076
6 SASI_Mm02_00346603 predicted 2299
7 SASI_Mm01_00128782 predicted 1909
8 SASI_Mm01_00128783 predicted 373
9 SASI_Mm01_00128784 predicted 1004
10 SASI_Mm01_00128785 predicted 1294
11 SASI_Mm01_00128781 predicted 2743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175667
ANKEF1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and EF-hand domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-2240s21c1
Sequence:CCGGGACATGCTGCCATGGATATTGCTCGAGCAATATCCATGGCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-1582s21c1
Sequence:CCGGTCGTACGTATTGGGATCTTTCCTCGAGGAAAGATCCCAATACGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175667.2-2872s1c1
Sequence:CCGGCCAGAGTCAAAGTTTGGAGAACTCGAGTTCTCCAAACTTTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-1635s1c1
Sequence:CCGGCCGTTGCTCAAATGCACGAAACTCGAGTTTCGTGCATTTGAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-781s1c1
Sequence:CCGGCCATGAGTTGTCAATGGAAATCTCGAGATTTCCATTGACAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2333s1c1
Sequence:CCGGCTACTTGATATGGGTGCCAAACTCGAGTTTGGCACCCATATCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2054s1c1
Sequence:CCGGCCCGTGGATATGAAGGACAATCTCGAGATTGTCCTTCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175667
ANKEF1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and EF-hand domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-2240s21c1
Sequence:CCGGGACATGCTGCCATGGATATTGCTCGAGCAATATCCATGGCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-1582s21c1
Sequence:CCGGTCGTACGTATTGGGATCTTTCCTCGAGGAAAGATCCCAATACGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175667.2-2872s1c1
Sequence:CCGGCCAGAGTCAAAGTTTGGAGAACTCGAGTTCTCCAAACTTTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-1635s1c1
Sequence:CCGGCCGTTGCTCAAATGCACGAAACTCGAGTTTCGTGCATTTGAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-781s1c1
Sequence:CCGGCCATGAGTTGTCAATGGAAATCTCGAGATTTCCATTGACAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2333s1c1
Sequence:CCGGCTACTTGATATGGGTGCCAAACTCGAGTTTGGCACCCATATCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2054s1c1
Sequence:CCGGCCCGTGGATATGAAGGACAATCTCGAGATTGTCCTTCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175667
ANKEF1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and EF-hand domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-2240s21c1
Sequence:CCGGGACATGCTGCCATGGATATTGCTCGAGCAATATCCATGGCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175667.4-1582s21c1
Sequence:CCGGTCGTACGTATTGGGATCTTTCCTCGAGGAAAGATCCCAATACGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175667.2-2872s1c1
Sequence:CCGGCCAGAGTCAAAGTTTGGAGAACTCGAGTTCTCCAAACTTTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-1635s1c1
Sequence:CCGGCCGTTGCTCAAATGCACGAAACTCGAGTTTCGTGCATTTGAGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-781s1c1
Sequence:CCGGCCATGAGTTGTCAATGGAAATCTCGAGATTTCCATTGACAACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2333s1c1
Sequence:CCGGCTACTTGATATGGGTGCCAAACTCGAGTTTGGCACCCATATCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175667.2-2054s1c1
Sequence:CCGGCCCGTGGATATGAAGGACAATCTCGAGATTGTCCTTCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022096
VALIDATED
ANKEF1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and EF-hand domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022096.4-830s21c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-3005s21c1
Sequence:CCGGTTACCAGGTCTACACCATTATCTCGAGATAATGGTGTAGACCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-1942s21c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-556s21c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-1942s1c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-2095s1c1
Sequence:CCGGGCAGGCCAACAAGACATTGTTCTCGAGAACAATGTCTTGTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022096.4-2220s1c1
Sequence:CCGGCCTACTTGATATTGGTGCTAACTCGAGTTAGCACCAATATCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-556s1c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-830s1c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022096
VALIDATED
ANKEF1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and EF-hand domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022096.4-830s21c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-3005s21c1
Sequence:CCGGTTACCAGGTCTACACCATTATCTCGAGATAATGGTGTAGACCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-1942s21c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-556s21c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-1942s1c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-2095s1c1
Sequence:CCGGGCAGGCCAACAAGACATTGTTCTCGAGAACAATGTCTTGTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022096.4-2220s1c1
Sequence:CCGGCCTACTTGATATTGGTGCTAACTCGAGTTAGCACCAATATCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-556s1c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-830s1c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022096
VALIDATED
ANKEF1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and EF-hand domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022096.4-830s21c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-3005s21c1
Sequence:CCGGTTACCAGGTCTACACCATTATCTCGAGATAATGGTGTAGACCTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-1942s21c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_022096.4-556s21c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-1942s1c1
Sequence:CCGGCCTGTGGATATGAAGGATAATCTCGAGATTATCCTTCATATCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-2095s1c1
Sequence:CCGGGCAGGCCAACAAGACATTGTTCTCGAGAACAATGTCTTGTTGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022096.4-2220s1c1
Sequence:CCGGCCTACTTGATATTGGTGCTAACTCGAGTTAGCACCAATATCAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-556s1c1
Sequence:CCGGGCCTCAGTTTCCAATGATATTCTCGAGAATATCATTGGAAACTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022096.4-830s1c1
Sequence:CCGGCCTATGAAGGAAAGCCAATATCTCGAGATATTGGCTTTCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks