EMAIL THIS PAGE TO A FRIEND

ANKFN1

ankyrin-repeat and fibronectin type III domain containing 1

54 Gene Product Result for
UniProtKB ID: Q8N957
Gene ID:
Mouse(382543) ankyrin-repeat and fibronectin type III domain containing 1
Rat(303437) ankyrin-repeat and fibronectin type III domain containing 1
chicken(427807) ankyrin-repeat and fibronectin type III domain containing 1
domestic cat(101084916) ankyrin-repeat and fibronectin type III domain containing 1
cow(527335) ankyrin-repeat and fibronectin type III domain containing 1
dog(491099) ankyrin-repeat and fibronectin type III domain containing 1
domestic guinea pig(100734147) ankyrin-repeat and fibronectin type III domain containing 1
sheep(101122610) ankyrin-repeat and fibronectin type III domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU180461 MISSION® esiRNA esiRNA targeting mouse Ankfn1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153228 Rosetta Predictions human pricing
NM_001080933 Rosetta Predictions mouse pricing
XM_356556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367089 predicted 1352
2 SASI_Hs02_00367090 predicted 739
3 SASI_Hs01_00176240 predicted 1608
4 SASI_Hs02_00367091 predicted 776
5 SASI_Hs01_00176241 predicted 1061
6 SASI_Hs01_00176242 predicted 1041
7 SASI_Hs02_00367092 predicted 1834
8 SASI_Hs01_00176244 predicted 1862
9 SASI_Hs01_00176245 predicted 2021
10 SASI_Hs01_00176247 predicted 931
11 SASI_Hs01_00176243 predicted 1416
12 SASI_Hs01_00176246 predicted 1146
13 SASI_Hs01_00176248 predicted 403
14 SASI_Hs01_00176249 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294033 predicted 1209
2 SASI_Mm02_00294034 predicted 277
3 SASI_Mm02_00294035 predicted 971
4 SASI_Mm02_00294036 predicted 1770
5 SASI_Mm02_00294037 predicted 1311
6 SASI_Mm02_00294038 predicted 1524
7 SASI_Mm02_00294039 predicted 1256
8 SASI_Mm02_00294040 predicted 1593
9 SASI_Mm02_00294041 predicted 1330
10 SASI_Mm02_00294042 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270180 predicted 1218
2 SASI_Mm01_00270181 predicted 283
3 SASI_Mm01_00270182 predicted 976
4 SASI_Mm01_00270183 predicted 574
5 SASI_Mm01_00270184 predicted 1530
6 SASI_Mm01_00270185 predicted 1259
7 SASI_Mm01_00270186 predicted 1601
8 SASI_Mm01_00270187 predicted 1334
9 SASI_Mm01_00270188 predicted 1712
10 SASI_Mm01_00270189 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153228
ANKFN1 MISSION shRNA Bacterial Glycerol Stock
ankyrin-repeat and fibronectin type III domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1078s1c1
Sequence:CCGGCGGCTTACAATATGAAAGGATCTCGAGATCCTTTCATATTGTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1514s1c1
Sequence:CCGGGCTGAGGCAAAGCATACCAATCTCGAGATTGGTATGCTTTGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-933s1c1
Sequence:CCGGGCTGTAGTAACCAGGTATAAACTCGAGTTTATACCTGGTTACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-178s1c1
Sequence:CCGGGCACTGGACAATTACCAACAACTCGAGTTGTTGGTAATTGTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1656s1c1
Sequence:CCGGCGACATGGAAACATACTCATACTCGAGTATGAGTATGTTTCCATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1866s21c1
Sequence:CCGGTTATATCTGGGTTACCTAAAGCTCGAGCTTTAGGTAACCCAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1889s21c1
Sequence:CCGGCTGTAGCTCTGTGGATCAAATCTCGAGATTTGATCCACAGAGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1632s21c1
Sequence:CCGGGTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153228
ANKFN1 MISSION shRNA shRNA Plasmid DNA
ankyrin-repeat and fibronectin type III domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1078s1c1
Sequence:CCGGCGGCTTACAATATGAAAGGATCTCGAGATCCTTTCATATTGTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1514s1c1
Sequence:CCGGGCTGAGGCAAAGCATACCAATCTCGAGATTGGTATGCTTTGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-933s1c1
Sequence:CCGGGCTGTAGTAACCAGGTATAAACTCGAGTTTATACCTGGTTACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-178s1c1
Sequence:CCGGGCACTGGACAATTACCAACAACTCGAGTTGTTGGTAATTGTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1656s1c1
Sequence:CCGGCGACATGGAAACATACTCATACTCGAGTATGAGTATGTTTCCATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1866s21c1
Sequence:CCGGTTATATCTGGGTTACCTAAAGCTCGAGCTTTAGGTAACCCAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1889s21c1
Sequence:CCGGCTGTAGCTCTGTGGATCAAATCTCGAGATTTGATCCACAGAGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1632s21c1
Sequence:CCGGGTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153228
ANKFN1 MISSION shRNA Lentiviral Transduction Particles
ankyrin-repeat and fibronectin type III domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1078s1c1
Sequence:CCGGCGGCTTACAATATGAAAGGATCTCGAGATCCTTTCATATTGTAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1514s1c1
Sequence:CCGGGCTGAGGCAAAGCATACCAATCTCGAGATTGGTATGCTTTGCCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-933s1c1
Sequence:CCGGGCTGTAGTAACCAGGTATAAACTCGAGTTTATACCTGGTTACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-178s1c1
Sequence:CCGGGCACTGGACAATTACCAACAACTCGAGTTGTTGGTAATTGTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153228.1-1656s1c1
Sequence:CCGGCGACATGGAAACATACTCATACTCGAGTATGAGTATGTTTCCATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1866s21c1
Sequence:CCGGTTATATCTGGGTTACCTAAAGCTCGAGCTTTAGGTAACCCAGATATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1889s21c1
Sequence:CCGGCTGTAGCTCTGTGGATCAAATCTCGAGATTTGATCCACAGAGCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153228.2-1632s21c1
Sequence:CCGGGTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080933
ANKFN1 MISSION shRNA Bacterial Glycerol Stock
ankyrin-repeat and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1207s21c1
Sequence:CCGGAGGAGCCTGAAGCACCTATTTCTCGAGAAATAGGTGCTTCAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-406s21c1
Sequence:CCGGCAACTCCTCCTCTACCAATATCTCGAGATATTGGTAGAGGAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1266s21c1
Sequence:CCGGACTTTACATAGCCACTATATTCTCGAGAATATAGTGGCTATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1543s21c1
Sequence:CCGGCTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-845s21c1
Sequence:CCGGCCGTAGTGACCAGGTACAAAGCTCGAGCTTTGTACCTGGTCACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080933
ANKFN1 MISSION shRNA shRNA Plasmid DNA
ankyrin-repeat and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1207s21c1
Sequence:CCGGAGGAGCCTGAAGCACCTATTTCTCGAGAAATAGGTGCTTCAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-406s21c1
Sequence:CCGGCAACTCCTCCTCTACCAATATCTCGAGATATTGGTAGAGGAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1266s21c1
Sequence:CCGGACTTTACATAGCCACTATATTCTCGAGAATATAGTGGCTATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1543s21c1
Sequence:CCGGCTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-845s21c1
Sequence:CCGGCCGTAGTGACCAGGTACAAAGCTCGAGCTTTGTACCTGGTCACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080933
ANKFN1 MISSION shRNA Lentiviral Transduction Particles
ankyrin-repeat and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1207s21c1
Sequence:CCGGAGGAGCCTGAAGCACCTATTTCTCGAGAAATAGGTGCTTCAGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-406s21c1
Sequence:CCGGCAACTCCTCCTCTACCAATATCTCGAGATATTGGTAGAGGAGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1266s21c1
Sequence:CCGGACTTTACATAGCCACTATATTCTCGAGAATATAGTGGCTATGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-1543s21c1
Sequence:CCGGCTTTACTATGAGCCCATTAAACTCGAGTTTAATGGGCTCATAGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080933.1-845s21c1
Sequence:CCGGCCGTAGTGACCAGGTACAAAGCTCGAGCTTTGTACCTGGTCACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks