EMAIL THIS PAGE TO A FRIEND

ANKFY1

ankyrin repeat and FYVE domain containing 1

149 Gene Product Result for
Synonyms: ANKHZN BTBD23 ZFYVE14
UniProtKB ID: Q9P2R3, A8KA65, Q5RKV4, Q9ULG5
Gene ID:
Human(51479) Summary: This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
Mouse(11736) ankyrin repeat and FYVE domain containing 1
Rat(303292) ankyrin repeat and FYVE domain containing 1
sheep(101102652) ankyrin repeat and FYVE domain containing 1
Domestic Rabbit(100354216) ankyrin repeat and FYVE domain containing 1
naked mole-rat(101717588) ankyrin repeat and FYVE domain containing 1
domestic guinea pig(100730181) ankyrin repeat and FYVE domain containing 1
Zebrafish(568480) ankyrin repeat and FYVE domain containing 1
cow(528403) ankyrin repeat and FYVE domain containing 1
Horse(100072709) ankyrin repeat and FYVE domain containing 1
chicken(417494) ankyrin repeat and FYVE domain containing 1
domestic cat(101086762) ankyrin repeat and FYVE domain containing 1
dog(489438) ankyrin repeat and FYVE domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016376 Rosetta Predictions human pricing
NM_020740 Rosetta Predictions human pricing
NM_001107018 Rosetta Predictions rat pricing
NM_009671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349368 predicted 1163
2 SASI_Hs01_00232767 predicted 266
3 SASI_Hs01_00232769 predicted 778
4 SASI_Hs01_00232770 predicted 498
5 SASI_Hs01_00232772 predicted 1055
6 SASI_Hs01_00232773 predicted 698
7 SASI_Hs01_00232774 predicted 579
8 SASI_Hs01_00232775 predicted 923
9 SASI_Hs02_00349369 predicted 266
10 SASI_Hs01_00232776 predicted 445
11 SASI_Hs01_00232768 predicted 1133
12 SASI_Hs01_00232771 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353837 predicted 1164
2 SASI_Hs01_00067325 predicted 264
3 SASI_Hs01_00067327 predicted 773
4 SASI_Hs01_00067328 predicted 507
5 SASI_Hs01_00067330 predicted 1052
6 SASI_Hs01_00067331 predicted 693
7 SASI_Hs01_00067332 predicted 576
8 SASI_Hs01_00067333 predicted 927
9 SASI_Hs02_00353838 predicted 265
10 SASI_Hs01_00067334 predicted 447
11 SASI_Hs01_00067326 predicted 1140
12 SASI_Hs01_00067329 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224676 predicted 2260
2 SASI_Rn02_00224677 predicted 2514
3 SASI_Rn02_00224678 predicted 3487
4 SASI_Rn02_00224679 predicted 3328
5 SASI_Rn02_00224680 predicted 3155
6 SASI_Rn02_00224681 predicted 2107
7 SASI_Rn02_00224682 predicted 2817
8 SASI_Rn02_00224683 predicted 1792
9 SASI_Rn02_00224684 predicted 1791
10 SASI_Rn02_00224685 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147652 predicted 672
2 SASI_Mm01_00147653 predicted 996
3 SASI_Mm01_00147655 predicted 1176
4 SASI_Mm01_00147656 predicted 2392
5 SASI_Mm01_00147657 predicted 758
6 SASI_Mm01_00147658 predicted 853
7 SASI_Mm01_00147659 predicted 3272
8 SASI_Mm01_00147660 predicted 485
9 SASI_Mm01_00147661 predicted 2783
10 SASI_Mm02_00316711 predicted 430
11 SASI_Mm01_00147654 predicted 2624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020740
VALIDATED
ANKFY1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and FYVE domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-832s21c1
Sequence:CCGGCACGACGACTGGAGAGTATTGCTCGAGCAATACTCTCCAGTCGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-798s21c1
Sequence:CCGGCATAACGGAGATCTGGCATTACTCGAGTAATGCCAGATCTCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-385s21c1
Sequence:CCGGCAATGCTTCGCTGGATCTATACTCGAGTATAGATCCAGCGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-237s21c1
Sequence:CCGGTACAGCGATCTGAAGATAAAGCTCGAGCTTTATCTTCAGATCGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-508s21c1
Sequence:CCGGGTGTTATGTCTCTAGTGAATGCTCGAGCATTCACTAGAGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020740.2-1743s21c1
Sequence:CCGGACCATATTAGACTACACTTTGCTCGAGCAAAGTGTAGTCTAATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-348s21c1
Sequence:CCGGTTGGACCTGTCAGATGCTAATCTCGAGATTAGCATCTGACAGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-1066s21c1
Sequence:CCGGTGTCTGAGATGGCGCAGATTGCTCGAGCAATCTGCGCCATCTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1295s1c1
Sequence:CCGGCCGTGGTAAATGGGACTTCATCTCGAGATGAAGTCCCATTTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-675s1c1
Sequence:CCGGCCCGCTACATAAAGCCATCAACTCGAGTTGATGGCTTTATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-1432s1c1
Sequence:CCGGCGCCAGGAAATGGCATGTAAACTCGAGTTTACATGCCATTTCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1176s1c1
Sequence:CCGGGCAGTGCAAACAACTAGATTTCTCGAGAAATCTAGTTGTTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-688s1c1
Sequence:CCGGGCCATCAAAGTGGAGAGAGAACTCGAGTTCTCTCTCCACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020740
VALIDATED
ANKFY1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and FYVE domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-832s21c1
Sequence:CCGGCACGACGACTGGAGAGTATTGCTCGAGCAATACTCTCCAGTCGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-798s21c1
Sequence:CCGGCATAACGGAGATCTGGCATTACTCGAGTAATGCCAGATCTCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-385s21c1
Sequence:CCGGCAATGCTTCGCTGGATCTATACTCGAGTATAGATCCAGCGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-237s21c1
Sequence:CCGGTACAGCGATCTGAAGATAAAGCTCGAGCTTTATCTTCAGATCGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-508s21c1
Sequence:CCGGGTGTTATGTCTCTAGTGAATGCTCGAGCATTCACTAGAGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020740.2-1743s21c1
Sequence:CCGGACCATATTAGACTACACTTTGCTCGAGCAAAGTGTAGTCTAATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-348s21c1
Sequence:CCGGTTGGACCTGTCAGATGCTAATCTCGAGATTAGCATCTGACAGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-1066s21c1
Sequence:CCGGTGTCTGAGATGGCGCAGATTGCTCGAGCAATCTGCGCCATCTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1295s1c1
Sequence:CCGGCCGTGGTAAATGGGACTTCATCTCGAGATGAAGTCCCATTTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-675s1c1
Sequence:CCGGCCCGCTACATAAAGCCATCAACTCGAGTTGATGGCTTTATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-1432s1c1
Sequence:CCGGCGCCAGGAAATGGCATGTAAACTCGAGTTTACATGCCATTTCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1176s1c1
Sequence:CCGGGCAGTGCAAACAACTAGATTTCTCGAGAAATCTAGTTGTTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-688s1c1
Sequence:CCGGGCCATCAAAGTGGAGAGAGAACTCGAGTTCTCTCTCCACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020740
VALIDATED
ANKFY1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and FYVE domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-832s21c1
Sequence:CCGGCACGACGACTGGAGAGTATTGCTCGAGCAATACTCTCCAGTCGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-798s21c1
Sequence:CCGGCATAACGGAGATCTGGCATTACTCGAGTAATGCCAGATCTCCGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-385s21c1
Sequence:CCGGCAATGCTTCGCTGGATCTATACTCGAGTATAGATCCAGCGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-237s21c1
Sequence:CCGGTACAGCGATCTGAAGATAAAGCTCGAGCTTTATCTTCAGATCGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-508s21c1
Sequence:CCGGGTGTTATGTCTCTAGTGAATGCTCGAGCATTCACTAGAGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020740.2-1743s21c1
Sequence:CCGGACCATATTAGACTACACTTTGCTCGAGCAAAGTGTAGTCTAATATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-348s21c1
Sequence:CCGGTTGGACCTGTCAGATGCTAATCTCGAGATTAGCATCTGACAGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020740.2-1066s21c1
Sequence:CCGGTGTCTGAGATGGCGCAGATTGCTCGAGCAATCTGCGCCATCTCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1295s1c1
Sequence:CCGGCCGTGGTAAATGGGACTTCATCTCGAGATGAAGTCCCATTTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-675s1c1
Sequence:CCGGCCCGCTACATAAAGCCATCAACTCGAGTTGATGGCTTTATGTAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-1432s1c1
Sequence:CCGGCGCCAGGAAATGGCATGTAAACTCGAGTTTACATGCCATTTCCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020740.1-1176s1c1
Sequence:CCGGGCAGTGCAAACAACTAGATTTCTCGAGAAATCTAGTTGTTTGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020740.1-688s1c1
Sequence:CCGGGCCATCAAAGTGGAGAGAGAACTCGAGTTCTCTCTCCACTTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009671
VALIDATED
ANKFY1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-3412s21c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-212s21c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-62s21c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-634s21c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-767s21c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-3459s1c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-765s1c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-632s1c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-60s1c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-210s1c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009671
VALIDATED
ANKFY1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-3412s21c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-212s21c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-62s21c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-634s21c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-767s21c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-3459s1c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-765s1c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-632s1c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-60s1c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-210s1c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009671
VALIDATED
ANKFY1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and FYVE domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-3412s21c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-212s21c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-62s21c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-634s21c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009671.5-767s21c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-3459s1c1
Sequence:CCGGGCCGTCTTCTTTGCCATAAATCTCGAGATTTATGGCAAAGAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-765s1c1
Sequence:CCGGGCTTAACGAAACAGATCATAACTCGAGTTATGATCTGTTTCGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009671.2-632s1c1
Sequence:CCGGGCCTGAGTGCTCAGTTGTTATCTCGAGATAACAACTGAGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-60s1c1
Sequence:CCGGGATGCTTCTAAGACAAGAGTACTCGAGTACTCTTGTCTTAGAAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009671.2-210s1c1
Sequence:CCGGGCAAGAGCAGTACAGTGATTTCTCGAGAAATCACTGTACTGCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks