EMAIL THIS PAGE TO A FRIEND

ANKH

ANKH inorganic pyrophosphate transport regulator

81 Gene Product Result for
Synonyms: ANK CCAL2 CMDJ CPPDD HANK MANK
UniProtKB ID: Q9HCJ1, B2RCA7, D3DTD4, Q9NQW2
Gene ID:
Human(56172) Summary: This gene encodes a multipass transmembrane protein that is expressed in joints and other tissues and controls pyrophosphate levels in cultured cells. Progressive ankylosis-mediated control of pyrophosphate levels has been suggested as a possible mechanism regulating tissue calcification and susceptibility to arthritis in higher animals. Mutations in this gene have been associated with autosomal dominant craniometaphyseal dysplasia. [provided by RefSeq, Jul 2008]
Rat(114506) ANKH inorganic pyrophosphate transport regulator
chicken(420917) ankylosis, progressive homolog (mouse)
cow(511800) ankylosis, progressive homolog (mouse)
Horse(100070193) ankylosis, progressive homolog (mouse)
domestic cat(101090416) ankylosis, progressive homolog (mouse)
dog(491486) ankylosis, progressive homolog (mouse)
domestic guinea pig(100719766) ANKH inorganic pyrophosphate transport regulator
naked mole-rat(101699913) ankylosis, progressive homolog (mouse)
sheep(101103426) ankylosis, progressive homolog (mouse)
Domestic Rabbit(100343978) ankylosis, progressive homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054027 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008281 MISSION® esiRNA esiRNA targeting human ANKH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054027 Rosetta Predictions human pricing
NM_053714 Rosetta Predictions rat pricing
XM_001064426 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361967 predicted 1075
2 SASI_Hs02_00361968 predicted 1215
3 SASI_Hs01_00112956 predicted 1428
4 SASI_Hs01_00112957 predicted 635
5 SASI_Hs01_00112958 predicted 632
6 SASI_Hs01_00112961 predicted 822
7 SASI_Hs02_00361969 predicted 1204
8 SASI_Hs02_00361970 predicted 1091
9 SASI_Hs02_00361971 predicted 1220
10 SASI_Hs02_00361972 predicted 1077
11 SASI_Hs01_00112954 predicted 1660
12 SASI_Hs01_00112955 predicted 465
13 SASI_Hs01_00112959 predicted 625
14 SASI_Hs01_00112960 predicted 619
15 SASI_Hs01_00112962 predicted 1400
16 SASI_Hs01_00112963 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048904 predicted 1162
2 SASI_Rn01_00048906 predicted 614
3 SASI_Rn01_00048907 predicted 1641
4 SASI_Rn01_00048908 predicted 625
5 SASI_Rn01_00048909 predicted 790
6 SASI_Rn01_00048910 predicted 444
7 SASI_Rn01_00048911 predicted 952
8 SASI_Rn01_00048912 predicted 1035
9 SASI_Rn02_00266477 predicted 466
10 SASI_Rn02_00266478 predicted 1448
11 SASI_Rn01_00048905 predicted 1408
12 SASI_Rn01_00048913 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310452 predicted 954
2 SASI_Rn02_00310453 predicted 886
3 SASI_Rn02_00310454 predicted 342
4 SASI_Rn02_00310455 predicted 1390
5 SASI_Rn02_00310456 predicted 351
6 SASI_Rn02_00310457 predicted 541
7 SASI_Rn02_00310458 predicted 520
8 SASI_Rn02_00310459 predicted 1004
9 SASI_Rn02_00310460 predicted 680
10 SASI_Rn02_00310461 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054027
VALIDATED
ANKH MISSION shRNA Bacterial Glycerol Stock
ANKH inorganic pyrophosphate transport regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054027.3-1329s1c1
Sequence:CCGGACGCTCTGTTTCGTGATGTTTCTCGAGAAACATCACGAAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-625s1c1
Sequence:CCGGCACTGATAGCTTATAGTGATTCTCGAGAATCACTATAAGCTATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-947s1c1
Sequence:CCGGCCTGGGCTACTACAAGAACATCTCGAGATGTTCTTGTAGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-731s1c1
Sequence:CCGGCTTTCCTTTCATGGACGCAATCTCGAGATTGCGTCCATGAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-1083s1c1
Sequence:CCGGCGGCCTATTGTCAACCTCTTTCTCGAGAAAGAGGTTGACAATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-822s21c1
Sequence:CCGGCCTCAATCTCAGATGTCATAGCTCGAGCTATGACATCTGAGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-771s21c1
Sequence:CCGGCCCATGCTGGCATTCTCTTAACTCGAGTTAAGAGAATGCCAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-1993s21c1
Sequence:CCGGGGACCTAGTGAATGGTCTTTACTCGAGTAAAGACCATTCACTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-1053s21c1
Sequence:CCGGGGTGGCCTTTGGCTCTAATTCCTCGAGGAATTAGAGCCAAAGGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-2264s21c1
Sequence:CCGGCAGTCACATGGCCGTACAAAGCTCGAGCTTTGTACGGCCATGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054027
VALIDATED
ANKH MISSION shRNA shRNA Plasmid DNA
ANKH inorganic pyrophosphate transport regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054027.3-1329s1c1
Sequence:CCGGACGCTCTGTTTCGTGATGTTTCTCGAGAAACATCACGAAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-625s1c1
Sequence:CCGGCACTGATAGCTTATAGTGATTCTCGAGAATCACTATAAGCTATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-947s1c1
Sequence:CCGGCCTGGGCTACTACAAGAACATCTCGAGATGTTCTTGTAGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-731s1c1
Sequence:CCGGCTTTCCTTTCATGGACGCAATCTCGAGATTGCGTCCATGAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-1083s1c1
Sequence:CCGGCGGCCTATTGTCAACCTCTTTCTCGAGAAAGAGGTTGACAATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-822s21c1
Sequence:CCGGCCTCAATCTCAGATGTCATAGCTCGAGCTATGACATCTGAGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-771s21c1
Sequence:CCGGCCCATGCTGGCATTCTCTTAACTCGAGTTAAGAGAATGCCAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-1993s21c1
Sequence:CCGGGGACCTAGTGAATGGTCTTTACTCGAGTAAAGACCATTCACTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-1053s21c1
Sequence:CCGGGGTGGCCTTTGGCTCTAATTCCTCGAGGAATTAGAGCCAAAGGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-2264s21c1
Sequence:CCGGCAGTCACATGGCCGTACAAAGCTCGAGCTTTGTACGGCCATGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054027
VALIDATED
ANKH MISSION shRNA Lentiviral Transduction Particles
ANKH inorganic pyrophosphate transport regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054027.3-1329s1c1
Sequence:CCGGACGCTCTGTTTCGTGATGTTTCTCGAGAAACATCACGAAACAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-625s1c1
Sequence:CCGGCACTGATAGCTTATAGTGATTCTCGAGAATCACTATAAGCTATCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-947s1c1
Sequence:CCGGCCTGGGCTACTACAAGAACATCTCGAGATGTTCTTGTAGTAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-731s1c1
Sequence:CCGGCTTTCCTTTCATGGACGCAATCTCGAGATTGCGTCCATGAAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_054027.3-1083s1c1
Sequence:CCGGCGGCCTATTGTCAACCTCTTTCTCGAGAAAGAGGTTGACAATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-822s21c1
Sequence:CCGGCCTCAATCTCAGATGTCATAGCTCGAGCTATGACATCTGAGATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-771s21c1
Sequence:CCGGCCCATGCTGGCATTCTCTTAACTCGAGTTAAGAGAATGCCAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-1993s21c1
Sequence:CCGGGGACCTAGTGAATGGTCTTTACTCGAGTAAAGACCATTCACTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054027.4-1053s21c1
Sequence:CCGGGGTGGCCTTTGGCTCTAATTCCTCGAGGAATTAGAGCCAAAGGCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054027.4-2264s21c1
Sequence:CCGGCAGTCACATGGCCGTACAAAGCTCGAGCTTTGTACGGCCATGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks