EMAIL THIS PAGE TO A FRIEND

ANKHD1-EIF4EBP3

ANKHD1-EIF4EBP3 readthrough

56 Gene Product Result for
Synonyms: MASK-BP3 MASK-BP3ARF
Gene ID:
Human(404734) Summary: The ANKHD1-EIF4EBP3 mRNA is an infrequent but naturally occurring readthrough transcript of the neighboring ANKHD1 and EIF4EBP3 genes. This readthrough transcript encodes a protein composed mostly of the multiple ankyrin repeats, single KH-domain protein, with its C-terminus encoded in a different reading frame from the shared portion of the EIF4EBP3 gene. The significance of this readthrough mRNA and the function of its protein product have not yet been determined. [provided by RefSeq, Nov 2009]
Rat(679725) Ankhd1-Eif4ebp3 fusion transcript
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020690 Rosetta Predictions human pricing
XM_001054207 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225805 predicted 831
2 SASI_Hs01_00225806 predicted 1247
3 SASI_Hs01_00225807 predicted 899
4 SASI_Hs01_00225808 predicted 1571
5 SASI_Hs02_00353685 predicted 904
6 SASI_Hs01_00225809 predicted 861
7 SASI_Hs01_00225811 predicted 849
8 SASI_Hs01_00225812 predicted 882
9 SASI_Hs02_00353686 predicted 982
10 SASI_Hs01_00225813 predicted 969
11 SASI_Hs01_00225810 predicted 846
12 SASI_Hs01_00225814 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275087 predicted 3868
2 SASI_Rn02_00275088 predicted 1989
3 SASI_Rn02_00275089 predicted 5513
4 SASI_Rn02_00275090 predicted 1189
5 SASI_Rn02_00275091 predicted 3615
6 SASI_Rn02_00275092 predicted 7716
7 SASI_Rn02_00275093 predicted 7426
8 SASI_Rn02_00275094 predicted 4808
9 SASI_Rn02_00275095 predicted 7483
10 SASI_Rn02_00275096 predicted 3997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020690
VALIDATED
ANKHD1-EIF4EBP3 MISSION shRNA Bacterial Glycerol Stock
ANKHD1-EIF4EBP3 readthrough
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-7196s1c1
Sequence:CCGGGCCAGTCAAGATCGAAAGATACTCGAGTATCTTTCGATCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020690.4-5705s1c1
Sequence:CCGGGCTCAAACTATGCAACAGATTCTCGAGAATCTGTTGCATAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-2160s1c1
Sequence:CCGGGCCATACTAATGTAGTTTCTTCTCGAGAAGAAACTACATTAGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020690.4-7979s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020690
VALIDATED
ANKHD1-EIF4EBP3 MISSION shRNA shRNA Plasmid DNA
ANKHD1-EIF4EBP3 readthrough
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-7196s1c1
Sequence:CCGGGCCAGTCAAGATCGAAAGATACTCGAGTATCTTTCGATCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020690.4-5705s1c1
Sequence:CCGGGCTCAAACTATGCAACAGATTCTCGAGAATCTGTTGCATAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-2160s1c1
Sequence:CCGGGCCATACTAATGTAGTTTCTTCTCGAGAAGAAACTACATTAGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020690.4-7979s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020690
VALIDATED
ANKHD1-EIF4EBP3 MISSION shRNA Lentiviral Transduction Particles
ANKHD1-EIF4EBP3 readthrough
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-7196s1c1
Sequence:CCGGGCCAGTCAAGATCGAAAGATACTCGAGTATCTTTCGATCTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020690.4-5705s1c1
Sequence:CCGGGCTCAAACTATGCAACAGATTCTCGAGAATCTGTTGCATAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020690.4-2160s1c1
Sequence:CCGGGCCATACTAATGTAGTTTCTTCTCGAGAAGAAACTACATTAGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020690.4-7979s1c1
Sequence:CCGGCGCACAATTTGAAATGGACATCTCGAGATGTCCATTTCAAATTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks