EMAIL THIS PAGE TO A FRIEND

ANKHD1

ankyrin repeat and KH domain containing 1

Synonyms: MASK VBARP
Gene ID:
Human(54882) Summary: This gene encodes a protein with multiple ankyrin repeat domains and a single KH-domain. The protein is thought to function as a scaffolding protein, and it may be involved in the regulation of caspases and thereby play an antiapoptotic role in cell survival. Alternative splicing results in multiple transcript variants, one of which generates a fusion transcript (MASK-BP3) with the downstream eIF4E-binding protein 3 (EIF4EBP3) gene, resulting in a protein comprised of the ANKHD1 sequence for the majority of the protein and a different C-terminus due to an alternate reading frame for the EIF4EBP3 segments. [provided by RefSeq, Sep 2010]
Mouse(108857) ankyrin repeat and KH domain containing 1
Rat(100529260) ankyrin repeat and KH domain containing 1
Zebrafish(563327) ankyrin repeat and KH domain containing 1
chicken(416143) ankyrin repeat and KH domain containing 1
domestic cat(101093912) ankyrin repeat and KH domain containing 1
cow(509490) ankyrin repeat and KH domain containing 1
Horse(100072419) ankyrin repeat and KH domain containing 1
dog(612748) ankyrin repeat and KH domain containing 1
sheep(101121602) ankyrin repeat and KH domain containing 1
Domestic Rabbit(100345664) ankyrin repeat and KH domain containing 1
domestic guinea pig(100734191) ankyrin repeat and KH domain containing 1
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097031 MISSION® esiRNA esiRNA human ANKHD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017747 Rosetta Predictions human pricing
NM_017978 Rosetta Predictions human pricing
NM_024668 Rosetta Predictions human pricing
NM_175375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187097 predicted 834
2 SASI_Hs01_00187098 predicted 1246
3 SASI_Hs01_00187099 predicted 896
4 SASI_Hs01_00187100 predicted 1576
5 SASI_Hs02_00350555 predicted 906
6 SASI_Hs01_00187101 predicted 866
7 SASI_Hs01_00187103 predicted 851
8 SASI_Hs01_00187104 predicted 884
9 SASI_Hs02_00350556 predicted 983
10 SASI_Hs01_00187105 predicted 970
11 SASI_Hs01_00187102 predicted 847
12 SASI_Hs01_00187106 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192855 predicted 799
2 SASI_Hs01_00192856 predicted 1205
3 SASI_Hs01_00192857 predicted 861
4 SASI_Hs01_00192858 predicted 1538
5 SASI_Hs02_00351018 predicted 874
6 SASI_Hs01_00192859 predicted 827
7 SASI_Hs01_00192861 predicted 822
8 SASI_Hs01_00192862 predicted 851
9 SASI_Hs02_00351019 predicted 948
10 SASI_Hs01_00192863 predicted 930
11 SASI_Hs01_00192860 predicted 822
12 SASI_Hs01_00192864 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107190 predicted 827
2 SASI_Hs01_00107191 predicted 1243
3 SASI_Hs01_00107192 predicted 892
4 SASI_Hs01_00107193 predicted 1570
5 SASI_Hs02_00357082 predicted 905
6 SASI_Hs01_00107194 predicted 865
7 SASI_Hs01_00107196 predicted 848
8 SASI_Hs01_00107197 predicted 882
9 SASI_Hs02_00357083 predicted 981
10 SASI_Hs01_00107198 predicted 961
11 SASI_Hs01_00107195 predicted 847
12 SASI_Hs01_00107199 predicted 1535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346190 predicted 786
2 SASI_Mm02_00346191 predicted 3906
3 SASI_Mm02_00346192 predicted 1489
4 SASI_Mm02_00346193 predicted 3256
5 SASI_Mm02_00346194 predicted 2139
6 SASI_Mm02_00346195 predicted 1433
7 SASI_Mm02_00346196 predicted 7021
8 SASI_Mm02_00346197 predicted 7266
9 SASI_Mm02_00346198 predicted 5958
10 SASI_Mm02_00346199 predicted 7501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024668
VALIDATED
ANKHD1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and KH domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024668.2-2022s21c1
Sequence:CCGGCCAGAACTCTGGATATCTGAACTCGAGTTCAGATATCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-1971s21c1
Sequence:CCGGTGGCCTTTGATGCTTGTAAGCCTCGAGGCTTACAAGCATCAAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-2002s21c1
Sequence:CCGGAGAATAGATGTTGTAGGTAACCTCGAGGTTACCTACAACATCTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1472s1c1
Sequence:CCGGCATGTTGAATTGGCAGCTCTACTCGAGTAGAGCTGCCAATTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1093s1c1
Sequence:CCGGGCTCCTTAATGAAGGTGCAAACTCGAGTTTGCACCTTCATTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1982s1c1
Sequence:CCGGGCTTGTAAGCTACTACGTAAACTCGAGTTTACGTAGTAGCTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-782s1c1
Sequence:CCGGGCTGTTCGTAAATTGCTAGATCTCGAGATCTAGCAATTTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-964s1c1
Sequence:CCGGCAGTGGAGGTTACTTAGATATCTCGAGATATCTAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1635s1c1
Sequence:CCGGCTCAAGAAACTGCTCTTACTTCTCGAGAAGTAAGAGCAGTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-923s1c1
Sequence:CCGGCGAGGGAATAAAGGAGACATACTCGAGTATGTCTCCTTTATTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1273s1c1
Sequence:CCGGCCATTTGGATATGGTTCGCTTCTCGAGAAGCGAACCATATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-1797s1c1
Sequence:CCGGGCGCTAATGTGCATGCTACAACTCGAGTTGTAGCATGCACATTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1586s1c1
Sequence:CCGGGCACTACTCTTAGCACAAGGACTCGAGTCCTTGTGCTAAGAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-744s1c1
Sequence:CCGGGCAGTCTAGCAGAAGCTTGTTCTCGAGAACAAGCTTCTGCTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024668
VALIDATED
ANKHD1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and KH domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024668.2-2022s21c1
Sequence:CCGGCCAGAACTCTGGATATCTGAACTCGAGTTCAGATATCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-1971s21c1
Sequence:CCGGTGGCCTTTGATGCTTGTAAGCCTCGAGGCTTACAAGCATCAAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-2002s21c1
Sequence:CCGGAGAATAGATGTTGTAGGTAACCTCGAGGTTACCTACAACATCTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1472s1c1
Sequence:CCGGCATGTTGAATTGGCAGCTCTACTCGAGTAGAGCTGCCAATTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1093s1c1
Sequence:CCGGGCTCCTTAATGAAGGTGCAAACTCGAGTTTGCACCTTCATTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1982s1c1
Sequence:CCGGGCTTGTAAGCTACTACGTAAACTCGAGTTTACGTAGTAGCTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-782s1c1
Sequence:CCGGGCTGTTCGTAAATTGCTAGATCTCGAGATCTAGCAATTTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-964s1c1
Sequence:CCGGCAGTGGAGGTTACTTAGATATCTCGAGATATCTAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1635s1c1
Sequence:CCGGCTCAAGAAACTGCTCTTACTTCTCGAGAAGTAAGAGCAGTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-923s1c1
Sequence:CCGGCGAGGGAATAAAGGAGACATACTCGAGTATGTCTCCTTTATTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1273s1c1
Sequence:CCGGCCATTTGGATATGGTTCGCTTCTCGAGAAGCGAACCATATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-1797s1c1
Sequence:CCGGGCGCTAATGTGCATGCTACAACTCGAGTTGTAGCATGCACATTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1586s1c1
Sequence:CCGGGCACTACTCTTAGCACAAGGACTCGAGTCCTTGTGCTAAGAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-744s1c1
Sequence:CCGGGCAGTCTAGCAGAAGCTTGTTCTCGAGAACAAGCTTCTGCTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024668
VALIDATED
ANKHD1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and KH domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024668.2-2022s21c1
Sequence:CCGGCCAGAACTCTGGATATCTGAACTCGAGTTCAGATATCCAGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-1971s21c1
Sequence:CCGGTGGCCTTTGATGCTTGTAAGCCTCGAGGCTTACAAGCATCAAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024668.2-2002s21c1
Sequence:CCGGAGAATAGATGTTGTAGGTAACCTCGAGGTTACCTACAACATCTATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1472s1c1
Sequence:CCGGCATGTTGAATTGGCAGCTCTACTCGAGTAGAGCTGCCAATTCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1093s1c1
Sequence:CCGGGCTCCTTAATGAAGGTGCAAACTCGAGTTTGCACCTTCATTAAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024668.2-1982s1c1
Sequence:CCGGGCTTGTAAGCTACTACGTAAACTCGAGTTTACGTAGTAGCTTACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-782s1c1
Sequence:CCGGGCTGTTCGTAAATTGCTAGATCTCGAGATCTAGCAATTTACGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-964s1c1
Sequence:CCGGCAGTGGAGGTTACTTAGATATCTCGAGATATCTAAGTAACCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1635s1c1
Sequence:CCGGCTCAAGAAACTGCTCTTACTTCTCGAGAAGTAAGAGCAGTTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-923s1c1
Sequence:CCGGCGAGGGAATAAAGGAGACATACTCGAGTATGTCTCCTTTATTCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024668.2-1273s1c1
Sequence:CCGGCCATTTGGATATGGTTCGCTTCTCGAGAAGCGAACCATATCCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-1797s1c1
Sequence:CCGGGCGCTAATGTGCATGCTACAACTCGAGTTGTAGCATGCACATTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024668.2-1586s1c1
Sequence:CCGGGCACTACTCTTAGCACAAGGACTCGAGTCCTTGTGCTAAGAGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024668.2-744s1c1
Sequence:CCGGGCAGTCTAGCAGAAGCTTGTTCTCGAGAACAAGCTTCTGCTAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175375
VALIDATED
ANKHD1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and KH domain containing 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5299s21c1
Sequence:CCGGGATGTTACTGGTGCCCATATTCTCGAGAATATGGGCACCAGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7996s1c1
Sequence:CCGGCTTGAGATCAGATGAACCTAGCTCGAGCTAGGTTCATCTGATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7946s1c1
Sequence:CCGGGATTTCCTATCCACCTGAATACTCGAGTATTCAGGTGGATAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5601s21c1
Sequence:CCGGTACGTTCCAGCCCACTAATAACTCGAGTTATTAGTGGGCTGGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-6702s21c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175375.3-7964s21c1
Sequence:CCGGATATGTTCTCTGGTTAGTTAACTCGAGTTAACTAACCAGAGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-795s21c1
Sequence:CCGGTGTGAATGCTGTTCGTAAATTCTCGAGAATTTACGAACAGCATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-669s1c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1627s1c1
Sequence:CCGGCCTGCTTGGAATCCTATGATACTCGAGTATCATAGGATTCCAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1596s1c1
Sequence:CCGGCCCACTGTTCAATGGACTTCACTCGAGTGAAGTCCATTGAACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-356s1c1
Sequence:CCGGCTGATTTAAGTCCTGTGTCAACTCGAGTTGACACAGGACTTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1728s1c1
Sequence:CCGGGCATCTCAAATATGTCAACTACTCGAGTAGTTGACATATTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1711s1c1
Sequence:CCGGCCTCATATTGGAAACATGCATCTCGAGATGCATGTTTCCAATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1362s1c1
Sequence:CCGGCAATGCTATGTCAGAAGGCTTCTCGAGAAGCCTTCTGACATAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-1063s1c1
Sequence:CCGGCCTAGTTTCAACAGACAACATCTCGAGATGTTGTCTGTTGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175375
VALIDATED
ANKHD1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and KH domain containing 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5299s21c1
Sequence:CCGGGATGTTACTGGTGCCCATATTCTCGAGAATATGGGCACCAGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7996s1c1
Sequence:CCGGCTTGAGATCAGATGAACCTAGCTCGAGCTAGGTTCATCTGATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7946s1c1
Sequence:CCGGGATTTCCTATCCACCTGAATACTCGAGTATTCAGGTGGATAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5601s21c1
Sequence:CCGGTACGTTCCAGCCCACTAATAACTCGAGTTATTAGTGGGCTGGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-6702s21c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175375.3-7964s21c1
Sequence:CCGGATATGTTCTCTGGTTAGTTAACTCGAGTTAACTAACCAGAGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-795s21c1
Sequence:CCGGTGTGAATGCTGTTCGTAAATTCTCGAGAATTTACGAACAGCATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-669s1c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1627s1c1
Sequence:CCGGCCTGCTTGGAATCCTATGATACTCGAGTATCATAGGATTCCAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1596s1c1
Sequence:CCGGCCCACTGTTCAATGGACTTCACTCGAGTGAAGTCCATTGAACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-356s1c1
Sequence:CCGGCTGATTTAAGTCCTGTGTCAACTCGAGTTGACACAGGACTTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1728s1c1
Sequence:CCGGGCATCTCAAATATGTCAACTACTCGAGTAGTTGACATATTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1711s1c1
Sequence:CCGGCCTCATATTGGAAACATGCATCTCGAGATGCATGTTTCCAATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1362s1c1
Sequence:CCGGCAATGCTATGTCAGAAGGCTTCTCGAGAAGCCTTCTGACATAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-1063s1c1
Sequence:CCGGCCTAGTTTCAACAGACAACATCTCGAGATGTTGTCTGTTGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175375
VALIDATED
ANKHD1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and KH domain containing 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5299s21c1
Sequence:CCGGGATGTTACTGGTGCCCATATTCTCGAGAATATGGGCACCAGTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217078    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7996s1c1
Sequence:CCGGCTTGAGATCAGATGAACCTAGCTCGAGCTAGGTTCATCTGATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175375.3-7946s1c1
Sequence:CCGGGATTTCCTATCCACCTGAATACTCGAGTATTCAGGTGGATAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-5601s21c1
Sequence:CCGGTACGTTCCAGCCCACTAATAACTCGAGTTATTAGTGGGCTGGAACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-6702s21c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175375.3-7964s21c1
Sequence:CCGGATATGTTCTCTGGTTAGTTAACTCGAGTTAACTAACCAGAGAACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175375.3-795s21c1
Sequence:CCGGTGTGAATGCTGTTCGTAAATTCTCGAGAATTTACGAACAGCATTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-669s1c1
Sequence:CCGGGCACATAAACCCAGCAAATAACTCGAGTTATTTGCTGGGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1627s1c1
Sequence:CCGGCCTGCTTGGAATCCTATGATACTCGAGTATCATAGGATTCCAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1596s1c1
Sequence:CCGGCCCACTGTTCAATGGACTTCACTCGAGTGAAGTCCATTGAACAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-356s1c1
Sequence:CCGGCTGATTTAAGTCCTGTGTCAACTCGAGTTGACACAGGACTTAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1728s1c1
Sequence:CCGGGCATCTCAAATATGTCAACTACTCGAGTAGTTGACATATTTGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175375.2-1711s1c1
Sequence:CCGGCCTCATATTGGAAACATGCATCTCGAGATGCATGTTTCCAATATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175375.2-1362s1c1
Sequence:CCGGCAATGCTATGTCAGAAGGCTTCTCGAGAAGCCTTCTGACATAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175375.2-1063s1c1
Sequence:CCGGCCTAGTTTCAACAGACAACATCTCGAGATGTTGTCTGTTGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks