EMAIL THIS PAGE TO A FRIEND

ANKIB1

ankyrin repeat and IBR domain containing 1

86 Gene Product Result for
UniProtKB ID: Q9P2G1, Q6GMS4, Q6P3S9, Q9NTD7, Q9NW49
Gene ID:
Mouse(70797) ankyrin repeat and IBR domain containing 1
Rat(368062) ankyrin repeat and IBR domain containing 1
Zebrafish(561277) ankyrin repeat and IBR domain containing 1
chicken(420550) ankyrin repeat and IBR domain containing 1
cow(505204) ankyrin repeat and IBR domain containing 1
Horse(100061269) ankyrin repeat and IBR domain containing 1
domestic cat(101084015) ankyrin repeat and IBR domain containing 1
dog(475226) ankyrin repeat and IBR domain containing 1
domestic guinea pig(100731492) ankyrin repeat and IBR domain containing 1
naked mole-rat(101722631) ankyrin repeat and IBR domain containing 1
sheep(101111273) ankyrin repeat and IBR domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_380018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_380018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_380018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019004 Rosetta Predictions human pricing
XM_377955 Rosetta Predictions human pricing
NM_001134781 Rosetta Predictions rat pricing
XM_001064190 Rosetta Predictions rat pricing
NM_001003909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352518 predicted 2930
2 SASI_Hs02_00352519 predicted 3626
3 SASI_Hs02_00352520 predicted 1027
4 SASI_Hs02_00352521 predicted 1981
5 SASI_Hs02_00352522 predicted 2991
6 SASI_Hs02_00352523 predicted 1574
7 SASI_Hs02_00352524 predicted 2141
8 SASI_Hs02_00352525 predicted 2195
9 SASI_Hs02_00352526 predicted 1126
10 SASI_Hs02_00352527 predicted 3329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_377955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274299 predicted 3364
2 SASI_Hs01_00274300 predicted 4050
3 SASI_Hs01_00274301 predicted 1970
4 SASI_Hs01_00274302 predicted 1462
5 SASI_Hs01_00274303 predicted 2414
6 SASI_Hs01_00274304 predicted 1443
7 SASI_Hs01_00274305 predicted 2008
8 SASI_Hs01_00274306 predicted 2565
9 SASI_Hs01_00274307 predicted 1062
10 SASI_Hs01_00274308 predicted 3756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258494 predicted 1523
2 SASI_Rn02_00258495 predicted 2153
3 SASI_Rn02_00258496 predicted 584
4 SASI_Rn02_00258497 predicted 3641
5 SASI_Rn02_00258498 predicted 2920
6 SASI_Rn02_00258499 predicted 2108
7 SASI_Rn02_00258500 predicted 450
8 SASI_Rn02_00258501 predicted 2409
9 SASI_Rn02_00258502 predicted 704
10 SASI_Rn02_00258503 predicted 2859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309629 predicted 1516
2 SASI_Rn02_00309630 predicted 2148
3 SASI_Rn02_00309631 predicted 577
4 SASI_Rn02_00309632 predicted 3647
5 SASI_Rn02_00309633 predicted 2922
6 SASI_Rn02_00309634 predicted 2115
7 SASI_Rn02_00309635 predicted 449
8 SASI_Rn02_00309636 predicted 2410
9 SASI_Rn02_00309637 predicted 708
10 SASI_Rn02_00309638 predicted 2852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134531 predicted 997
2 SASI_Mm01_00134533 predicted 2515
3 SASI_Mm01_00134534 predicted 3932
4 SASI_Mm01_00134535 predicted 2396
5 SASI_Mm01_00134536 predicted 859
6 SASI_Mm01_00134537 predicted 985
7 SASI_Mm02_00286344 predicted 2423
8 SASI_Mm01_00134539 predicted 1233
9 SASI_Mm01_00134540 predicted 1804
10 SASI_Mm02_00286345 predicted 3511
11 SASI_Mm01_00134532 predicted 2390
12 SASI_Mm01_00134538 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003909
VALIDATED
ANKIB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and IBR domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-3284s1c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-1622s1c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2240s1c1
Sequence:CCGGGAGCATAGTTATCAGTTAGAACTCGAGTTCTAACTGATAACTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2236s1c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003909.3-1007s21c1
Sequence:CCGGGGCTATTGATGCCGTTGATAACTCGAGTTATCAACGGCATCAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-3468s21c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-2420s21c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-1806s21c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003909
VALIDATED
ANKIB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and IBR domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-3284s1c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-1622s1c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2240s1c1
Sequence:CCGGGAGCATAGTTATCAGTTAGAACTCGAGTTCTAACTGATAACTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2236s1c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003909.3-1007s21c1
Sequence:CCGGGGCTATTGATGCCGTTGATAACTCGAGTTATCAACGGCATCAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-3468s21c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-2420s21c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-1806s21c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003909
VALIDATED
ANKIB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and IBR domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-3284s1c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-1622s1c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2240s1c1
Sequence:CCGGGAGCATAGTTATCAGTTAGAACTCGAGTTCTAACTGATAACTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003909.2-2236s1c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003909.3-1007s21c1
Sequence:CCGGGGCTATTGATGCCGTTGATAACTCGAGTTATCAACGGCATCAATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-3468s21c1
Sequence:CCGGCCCAGTGCCAATGACAATCTTCTCGAGAAGATTGTCATTGGCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-2420s21c1
Sequence:CCGGCCATGAGCATAGTTATCAGTTCTCGAGAACTGATAACTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003909.3-1806s21c1
Sequence:CCGGCGATACCTACAGTTTGATATTCTCGAGAATATCAAACTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380018
ANKIB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and IBR domain containing 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000122271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-515s1c1
Sequence:CCGGCCACAGAAGATGATTTCAGAACTCGAGTTCTGAAATCATCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-3085s1c1
Sequence:CCGGCCCAACATCAATGACAATCTTCTCGAGAAGATTGTCATTGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-2170s1c1
Sequence:CCGGCGCATTCTCAAGTGTTCTTATCTCGAGATAAGAACACTTGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380018
ANKIB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and IBR domain containing 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000122271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-515s1c1
Sequence:CCGGCCACAGAAGATGATTTCAGAACTCGAGTTCTGAAATCATCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-3085s1c1
Sequence:CCGGCCCAACATCAATGACAATCTTCTCGAGAAGATTGTCATTGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-2170s1c1
Sequence:CCGGCGCATTCTCAAGTGTTCTTATCTCGAGATAAGAACACTTGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380018
ANKIB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and IBR domain containing 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000122271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-515s1c1
Sequence:CCGGCCACAGAAGATGATTTCAGAACTCGAGTTCTGAAATCATCTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-3085s1c1
Sequence:CCGGCCCAACATCAATGACAATCTTCTCGAGAAGATTGTCATTGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380018.1-2170s1c1
Sequence:CCGGCGCATTCTCAAGTGTTCTTATCTCGAGATAAGAACACTTGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019004
VALIDATED
ANKIB1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and IBR domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1896s21c1
Sequence:CCGGCCAATTGTCTCTGGTTATTAACTCGAGTTAATAACCAGAGACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1673s21c1
Sequence:CCGGCTAACGAAACAAGGGTCAAATCTCGAGATTTGACCCTTGTTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-2044s21c1
Sequence:CCGGTTCGTCCACTGGAGGTTATTACTCGAGTAATAACCTCCAGTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-4654s21c1
Sequence:CCGGATAGTAAATCCCACGATTATTCTCGAGAATAATCGTGGGATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1247s21c1
Sequence:CCGGCCACCACCAAGTGGGTATAATCTCGAGATTATACCCACTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019004
VALIDATED
ANKIB1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and IBR domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1896s21c1
Sequence:CCGGCCAATTGTCTCTGGTTATTAACTCGAGTTAATAACCAGAGACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1673s21c1
Sequence:CCGGCTAACGAAACAAGGGTCAAATCTCGAGATTTGACCCTTGTTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-2044s21c1
Sequence:CCGGTTCGTCCACTGGAGGTTATTACTCGAGTAATAACCTCCAGTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-4654s21c1
Sequence:CCGGATAGTAAATCCCACGATTATTCTCGAGAATAATCGTGGGATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1247s21c1
Sequence:CCGGCCACCACCAAGTGGGTATAATCTCGAGATTATACCCACTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019004
VALIDATED
ANKIB1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and IBR domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1896s21c1
Sequence:CCGGCCAATTGTCTCTGGTTATTAACTCGAGTTAATAACCAGAGACAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1673s21c1
Sequence:CCGGCTAACGAAACAAGGGTCAAATCTCGAGATTTGACCCTTGTTTCGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-2044s21c1
Sequence:CCGGTTCGTCCACTGGAGGTTATTACTCGAGTAATAACCTCCAGTGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-4654s21c1
Sequence:CCGGATAGTAAATCCCACGATTATTCTCGAGAATAATCGTGGGATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_019004.1-1247s21c1
Sequence:CCGGCCACCACCAAGTGGGTATAATCTCGAGATTATACCCACTTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks