EMAIL THIS PAGE TO A FRIEND

ANKK1

ankyrin repeat and kinase domain containing 1

58 Gene Product Result for
Synonyms: PKK2
UniProtKB ID: Q8NFD2
Gene ID:
Human(255239) Summary: The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Mouse(244859) ankyrin repeat and kinase domain containing 1
Rat(367080) ankyrin repeat and kinase domain containing 1
Zebrafish(100170831) ankyrin repeat and kinase domain containing 1
cow(785303) ankyrin repeat and kinase domain containing 1
Horse(100054819) ankyrin repeat and kinase domain containing 1
domestic cat(101081829) ankyrin repeat and kinase domain containing 1
dog(489403) ankyrin repeat and kinase domain containing 1
chicken(100859406) ankyrin repeat and kinase domain containing 1
sheep(101109481) ankyrin repeat and kinase domain containing 1
naked mole-rat(101711084) ankyrin repeat and kinase domain containing 1
domestic guinea pig(100733049) ankyrin repeat and kinase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178510 Rosetta Predictions human pricing
NM_001108999 Rosetta Predictions rat pricing
NM_172922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154560 predicted 763
2 SASI_Hs01_00154562 predicted 371
3 SASI_Hs01_00154563 predicted 2127
4 SASI_Hs01_00154564 predicted 757
5 SASI_Hs01_00154565 predicted 1892
6 SASI_Hs01_00154566 predicted 2138
7 SASI_Hs01_00154567 predicted 1817
8 SASI_Hs01_00154568 predicted 699
9 SASI_Hs01_00154569 predicted 368
10 SASI_Hs02_00369754 predicted 374
11 SASI_Hs01_00154561 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244174 predicted 738
2 SASI_Rn02_00244175 predicted 904
3 SASI_Rn02_00244176 predicted 1045
4 SASI_Rn02_00244177 predicted 745
5 SASI_Rn02_00244178 predicted 435
6 SASI_Rn02_00244179 predicted 441
7 SASI_Rn02_00244180 predicted 451
8 SASI_Rn02_00244181 predicted 295
9 SASI_Rn02_00244182 predicted 921
10 SASI_Rn02_00244183 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199013 predicted 411
2 SASI_Mm01_00199014 predicted 533
3 SASI_Mm01_00199015 predicted 1071
4 SASI_Mm01_00199017 predicted 1816
5 SASI_Mm01_00199018 predicted 1052
6 SASI_Mm01_00199019 predicted 625
7 SASI_Mm01_00199020 predicted 456
8 SASI_Mm01_00199022 predicted 696
9 SASI_Mm02_00344924 predicted 915
10 SASI_Mm02_00344925 predicted 345
11 SASI_Mm01_00199016 predicted 2173
12 SASI_Mm01_00199021 predicted 2209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178510
ANKK1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and kinase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-918s21c1
Sequence:GTACCGGGGCCATGCTTTCTAGACATTACTCGAGTAATGTCTAGAAAGCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-2126s21c1
Sequence:GTACCGGCTCCTAGAACATCACGCAAATCTCGAGATTTGCGTGATGTTCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2125s1c1
Sequence:CCGGCCTCCTAGAACATCACGCAAACTCGAGTTTGCGTGATGTTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2114s1c1
Sequence:CCGGAGTGTCATCAACCTCCTAGAACTCGAGTTCTAGGAGGTTGATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-1499s1c1
Sequence:CCGGGCACAGAATAACTTTGAGAATCTCGAGATTCTCAAAGTTATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-373s1c1
Sequence:CCGGCCTGGGTATTGTGATGGAGTTCTCGAGAACTCCATCACAATACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-226s1c1
Sequence:CCGGGCGGACGGAGTACGCCATCAACTCGAGTTGATGGCGTACTCCGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-274s1c1
Sequence:CCGGCGCCAGCTCTGATGTGAATTACTCGAGTAATTCACATCAGAGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-445s1c1
Sequence:CCGGGAAGCTCAGGTTCCGCATCATCTCGAGATGATGCGGAACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-763s1c1
Sequence:CCGGGAAACCATACTCAGGGTTCAACTCGAGTTGAACCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178510
ANKK1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and kinase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-918s21c1
Sequence:GTACCGGGGCCATGCTTTCTAGACATTACTCGAGTAATGTCTAGAAAGCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-2126s21c1
Sequence:GTACCGGCTCCTAGAACATCACGCAAATCTCGAGATTTGCGTGATGTTCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2125s1c1
Sequence:CCGGCCTCCTAGAACATCACGCAAACTCGAGTTTGCGTGATGTTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2114s1c1
Sequence:CCGGAGTGTCATCAACCTCCTAGAACTCGAGTTCTAGGAGGTTGATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-1499s1c1
Sequence:CCGGGCACAGAATAACTTTGAGAATCTCGAGATTCTCAAAGTTATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-373s1c1
Sequence:CCGGCCTGGGTATTGTGATGGAGTTCTCGAGAACTCCATCACAATACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-226s1c1
Sequence:CCGGGCGGACGGAGTACGCCATCAACTCGAGTTGATGGCGTACTCCGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-274s1c1
Sequence:CCGGCGCCAGCTCTGATGTGAATTACTCGAGTAATTCACATCAGAGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-445s1c1
Sequence:CCGGGAAGCTCAGGTTCCGCATCATCTCGAGATGATGCGGAACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-763s1c1
Sequence:CCGGGAAACCATACTCAGGGTTCAACTCGAGTTGAACCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178510
ANKK1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and kinase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-918s21c1
Sequence:GTACCGGGGCCATGCTTTCTAGACATTACTCGAGTAATGTCTAGAAAGCATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178510.1-2126s21c1
Sequence:GTACCGGCTCCTAGAACATCACGCAAATCTCGAGATTTGCGTGATGTTCTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2125s1c1
Sequence:CCGGCCTCCTAGAACATCACGCAAACTCGAGTTTGCGTGATGTTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-2114s1c1
Sequence:CCGGAGTGTCATCAACCTCCTAGAACTCGAGTTCTAGGAGGTTGATGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-1499s1c1
Sequence:CCGGGCACAGAATAACTTTGAGAATCTCGAGATTCTCAAAGTTATTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178510.x-373s1c1
Sequence:CCGGCCTGGGTATTGTGATGGAGTTCTCGAGAACTCCATCACAATACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-226s1c1
Sequence:CCGGGCGGACGGAGTACGCCATCAACTCGAGTTGATGGCGTACTCCGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-274s1c1
Sequence:CCGGCGCCAGCTCTGATGTGAATTACTCGAGTAATTCACATCAGAGCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-445s1c1
Sequence:CCGGGAAGCTCAGGTTCCGCATCATCTCGAGATGATGCGGAACCTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178510.1-763s1c1
Sequence:CCGGGAAACCATACTCAGGGTTCAACTCGAGTTGAACCCTGAGTATGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172922
ANKK1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and kinase domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-1118s21c1
Sequence:CCGGCAAGTGATGTCTACGAGAATACTCGAGTATTCTCGTAGACATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-750s21c1
Sequence:CCGGGCTCAATATGATGACTATTATCTCGAGATAATAGTCATCATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-2173s21c1
Sequence:CCGGATCCTCAAAGTTCTAGTTAAACTCGAGTTTAACTAGAACTTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-109s1c1
Sequence:CCGGCGTCTTCACGAGGGATGATTTCTCGAGAAATCATCCCTCGTGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1556s1c1
Sequence:CCGGGCAGCCTACTTTGGTCACATTCTCGAGAATGTGACCAAAGTAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-538s1c1
Sequence:CCGGGCATGTCAAGATTTCCGATTTCTCGAGAAATCGGAAATCTTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1118s1c1
Sequence:CCGGGCAAGTGATGTCTACGAGAATCTCGAGATTCTCGTAGACATCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-2172s1c1
Sequence:CCGGCCATCCTCAAAGTTCTAGTTACTCGAGTAACTAGAACTTTGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172922
ANKK1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and kinase domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-1118s21c1
Sequence:CCGGCAAGTGATGTCTACGAGAATACTCGAGTATTCTCGTAGACATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-750s21c1
Sequence:CCGGGCTCAATATGATGACTATTATCTCGAGATAATAGTCATCATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-2173s21c1
Sequence:CCGGATCCTCAAAGTTCTAGTTAAACTCGAGTTTAACTAGAACTTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-109s1c1
Sequence:CCGGCGTCTTCACGAGGGATGATTTCTCGAGAAATCATCCCTCGTGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1556s1c1
Sequence:CCGGGCAGCCTACTTTGGTCACATTCTCGAGAATGTGACCAAAGTAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-538s1c1
Sequence:CCGGGCATGTCAAGATTTCCGATTTCTCGAGAAATCGGAAATCTTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1118s1c1
Sequence:CCGGGCAAGTGATGTCTACGAGAATCTCGAGATTCTCGTAGACATCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-2172s1c1
Sequence:CCGGCCATCCTCAAAGTTCTAGTTACTCGAGTAACTAGAACTTTGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172922
ANKK1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and kinase domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-1118s21c1
Sequence:CCGGCAAGTGATGTCTACGAGAATACTCGAGTATTCTCGTAGACATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-750s21c1
Sequence:CCGGGCTCAATATGATGACTATTATCTCGAGATAATAGTCATCATATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172922.3-2173s21c1
Sequence:CCGGATCCTCAAAGTTCTAGTTAAACTCGAGTTTAACTAGAACTTTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-109s1c1
Sequence:CCGGCGTCTTCACGAGGGATGATTTCTCGAGAAATCATCCCTCGTGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1556s1c1
Sequence:CCGGGCAGCCTACTTTGGTCACATTCTCGAGAATGTGACCAAAGTAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-538s1c1
Sequence:CCGGGCATGTCAAGATTTCCGATTTCTCGAGAAATCGGAAATCTTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-1118s1c1
Sequence:CCGGGCAAGTGATGTCTACGAGAATCTCGAGATTCTCGTAGACATCACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172922.1-2172s1c1
Sequence:CCGGCCATCCTCAAAGTTCTAGTTACTCGAGTAACTAGAACTTTGAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks