EMAIL THIS PAGE TO A FRIEND

ANKLE1

ankyrin repeat and LEM domain containing 1

80 Gene Product Result for
Synonyms: ANKRD41 LEM3 LEMD6
UniProtKB ID: Q8NAG6, A8VU82, Q8N8J8
Gene ID:
Mouse(234396) ankyrin repeat and LEM domain containing 1
Rat(361122) ankyrin repeat and LEM domain containing 1
domestic guinea pig(100731908) ankyrin repeat and LEM domain containing 1
naked mole-rat(101698380) ankyrin repeat and LEM domain containing 1
sheep(101115620) ankyrin repeat and LEM domain containing 1
chicken(100857739) ankyrin repeat and LEM domain containing 1
domestic cat(101082551) ankyrin repeat and LEM domain containing 1
cow(537502) ankyrin repeat and LEM domain containing 1
Horse(100070067) ankyrin repeat and LEM domain containing 1
dog(610155) ankyrin repeat and LEM domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152363 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152363 Rosetta Predictions human pricing
XM_341409 Rosetta Predictions rat pricing
XR_008568 Rosetta Predictions rat pricing
NM_172756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176330 predicted 1927
2 SASI_Hs02_00366007 predicted 372
3 SASI_Hs02_00366008 predicted 1348
4 SASI_Hs01_00176333 predicted 1293
5 SASI_Hs02_00366009 predicted 738
6 SASI_Hs01_00176334 predicted 1972
7 SASI_Hs01_00176335 predicted 924
8 SASI_Hs02_00366010 predicted 1387
9 SASI_Hs02_00366011 predicted 1787
10 SASI_Hs02_00366012 predicted 1306
11 SASI_Hs01_00176331 predicted 1010
12 SASI_Hs01_00176332 predicted 259
13 SASI_Hs01_00176336 predicted 562
14 SASI_Hs01_00176337 predicted 896
15 SASI_Hs01_00176338 predicted 1044
16 SASI_Hs01_00176339 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168121 predicted 435
2 SASI_Rn01_00168122 predicted 334
3 SASI_Rn01_00168123 predicted 343
4 SASI_Rn01_00168124 predicted 465
5 SASI_Rn01_00168125 predicted 232
6 SASI_Rn01_00168126 predicted 336
7 SASI_Rn01_00168127 predicted 340
8 SASI_Rn01_00168128 predicted 430
9 SASI_Rn01_00168129 predicted 340
10 SASI_Rn01_00168130 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417365 predicted 543
2 SASI_Rn02_00417366 predicted 1163
3 SASI_Rn02_00417367 predicted 946
4 SASI_Rn02_00417368 predicted 1143
5 SASI_Rn02_00417369 predicted 1645
6 SASI_Rn02_00417370 predicted 833
7 SASI_Rn02_00417371 predicted 1320
8 SASI_Rn02_00417372 predicted 1675
9 SASI_Rn02_00417373 predicted 1154
10 SASI_Rn01_00133270 predicted 345
11 SASI_Rn01_00133269 predicted 338
12 SASI_Rn01_00133271 predicted 225
13 SASI_Rn01_00133272 predicted 333
14 SASI_Rn01_00133273 predicted 344
15 SASI_Rn01_00133274 predicted 336
16 SASI_Rn01_00133275 predicted 259
17 SASI_Rn01_00133276 predicted 321
18 SASI_Rn01_00133277 predicted 264
19 SASI_Rn01_00133278 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344611 predicted 1431
2 SASI_Mm02_00344612 predicted 1111
3 SASI_Mm02_00344613 predicted 1309
4 SASI_Mm02_00344614 predicted 930
5 SASI_Mm02_00344615 predicted 1475
6 SASI_Mm02_00344616 predicted 1325
7 SASI_Mm02_00344617 predicted 1332
8 SASI_Mm02_00344618 predicted 1476
9 SASI_Mm02_00344619 predicted 496
10 SASI_Mm02_00344620 predicted 1214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172756
ANKLE1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and LEM domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-1954s1c1
Sequence:CCGGGTGACATGAATCCTGAGCCATCTCGAGATGGCTCAGGATTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1430s1c1
Sequence:CCGGCGGGAAGGCATTACAAAGTCTCTCGAGAGACTTTGTAATGCCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1253s1c1
Sequence:CCGGCCTTTCACCAGAGGACACTATCTCGAGATAGTGTCCTCTGGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-2021s1c1
Sequence:CCGGGCTTCAGAGGACAGTGTGTTTCTCGAGAAACACACTGTCCTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-543s21c1
Sequence:CCGGTTCGGAGTTGCACGTGCATAGCTCGAGCTATGCACGTGCAACTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-638s21c1
Sequence:CCGGACAGCAGCGATGCTTCGTTTGCTCGAGCAAACGAAGCATCGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172756
ANKLE1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and LEM domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-1954s1c1
Sequence:CCGGGTGACATGAATCCTGAGCCATCTCGAGATGGCTCAGGATTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1430s1c1
Sequence:CCGGCGGGAAGGCATTACAAAGTCTCTCGAGAGACTTTGTAATGCCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1253s1c1
Sequence:CCGGCCTTTCACCAGAGGACACTATCTCGAGATAGTGTCCTCTGGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-2021s1c1
Sequence:CCGGGCTTCAGAGGACAGTGTGTTTCTCGAGAAACACACTGTCCTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-543s21c1
Sequence:CCGGTTCGGAGTTGCACGTGCATAGCTCGAGCTATGCACGTGCAACTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-638s21c1
Sequence:CCGGACAGCAGCGATGCTTCGTTTGCTCGAGCAAACGAAGCATCGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172756
ANKLE1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and LEM domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-1954s1c1
Sequence:CCGGGTGACATGAATCCTGAGCCATCTCGAGATGGCTCAGGATTCATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1430s1c1
Sequence:CCGGCGGGAAGGCATTACAAAGTCTCTCGAGAGACTTTGTAATGCCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172756.1-1253s1c1
Sequence:CCGGCCTTTCACCAGAGGACACTATCTCGAGATAGTGTCCTCTGGTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172756.1-2021s1c1
Sequence:CCGGGCTTCAGAGGACAGTGTGTTTCTCGAGAAACACACTGTCCTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-543s21c1
Sequence:CCGGTTCGGAGTTGCACGTGCATAGCTCGAGCTATGCACGTGCAACTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172756.2-638s21c1
Sequence:CCGGACAGCAGCGATGCTTCGTTTGCTCGAGCAAACGAAGCATCGCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152363
ANKLE1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and LEM domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-631s1c1
Sequence:CCGGCCCTTGAAACTGTGGACAAACCTCGAGGTTTGTCCACAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1304s1c1
Sequence:CCGGCGTGAAGTCTAGCTTCACGTACTCGAGTACGTGAAGCTAGACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1400s1c1
Sequence:CCGGGACTTTCATCCGTGCCATCTTCTCGAGAAGATGGCACGGATGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2237s1c1
Sequence:CCGGGCACAAGATAACGGGTCATAACTCGAGTTATGACCCGTTATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2499s1c1
Sequence:CCGGCGAAACCCTATCTCTACTAAACTCGAGTTTAGTAGAGATAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1016s1c1
Sequence:CCGGGACATCCATTGATAGTGACATCTCGAGATGTCACTATCAATGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2191s1c1
Sequence:CCGGCCAGATGGTTAAAGCATTCTACTCGAGTAGAATGCTTTAACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1127s1c1
Sequence:CCGGGTCTGACTTGGAGTTGCTGAACTCGAGTTCAGCAACTCCAAGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1008s1c1
Sequence:CCGGGAGCACCAGACATCCATTGATCTCGAGATCAATGGATGTCTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1562s1c1
Sequence:CCGGCGTTGTGTCCCTACATTGCTTCTCGAGAAGCAATGTAGGGACACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152363
ANKLE1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and LEM domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-631s1c1
Sequence:CCGGCCCTTGAAACTGTGGACAAACCTCGAGGTTTGTCCACAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1304s1c1
Sequence:CCGGCGTGAAGTCTAGCTTCACGTACTCGAGTACGTGAAGCTAGACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1400s1c1
Sequence:CCGGGACTTTCATCCGTGCCATCTTCTCGAGAAGATGGCACGGATGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2237s1c1
Sequence:CCGGGCACAAGATAACGGGTCATAACTCGAGTTATGACCCGTTATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2499s1c1
Sequence:CCGGCGAAACCCTATCTCTACTAAACTCGAGTTTAGTAGAGATAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1016s1c1
Sequence:CCGGGACATCCATTGATAGTGACATCTCGAGATGTCACTATCAATGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2191s1c1
Sequence:CCGGCCAGATGGTTAAAGCATTCTACTCGAGTAGAATGCTTTAACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1127s1c1
Sequence:CCGGGTCTGACTTGGAGTTGCTGAACTCGAGTTCAGCAACTCCAAGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1008s1c1
Sequence:CCGGGAGCACCAGACATCCATTGATCTCGAGATCAATGGATGTCTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1562s1c1
Sequence:CCGGCGTTGTGTCCCTACATTGCTTCTCGAGAAGCAATGTAGGGACACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152363
ANKLE1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and LEM domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-631s1c1
Sequence:CCGGCCCTTGAAACTGTGGACAAACCTCGAGGTTTGTCCACAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1304s1c1
Sequence:CCGGCGTGAAGTCTAGCTTCACGTACTCGAGTACGTGAAGCTAGACTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1400s1c1
Sequence:CCGGGACTTTCATCCGTGCCATCTTCTCGAGAAGATGGCACGGATGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161295    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2237s1c1
Sequence:CCGGGCACAAGATAACGGGTCATAACTCGAGTTATGACCCGTTATCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2499s1c1
Sequence:CCGGCGAAACCCTATCTCTACTAAACTCGAGTTTAGTAGAGATAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1016s1c1
Sequence:CCGGGACATCCATTGATAGTGACATCTCGAGATGTCACTATCAATGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160617    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152363.2-2191s1c1
Sequence:CCGGCCAGATGGTTAAAGCATTCTACTCGAGTAGAATGCTTTAACCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1127s1c1
Sequence:CCGGGTCTGACTTGGAGTTGCTGAACTCGAGTTCAGCAACTCCAAGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1008s1c1
Sequence:CCGGGAGCACCAGACATCCATTGATCTCGAGATCAATGGATGTCTGGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152363.2-1562s1c1
Sequence:CCGGCGTTGTGTCCCTACATTGCTTCTCGAGAAGCAATGTAGGGACACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks