EMAIL THIS PAGE TO A FRIEND

ANKLE2

ankyrin repeat and LEM domain containing 2

220 Gene Product Result for
Synonyms: KIAA0692 LEMD7 Lem4
Gene ID:
Mouse(71782) ankyrin repeat and LEM domain containing 2
Rat(360829) ankyrin repeat and LEM domain containing 2
Zebrafish(559297) ankyrin repeat and LEM domain containing 2
cow(540159) ankyrin repeat and LEM domain containing 2
Horse(100061570) ankyrin repeat and LEM domain containing 2
domestic cat(101093717) ankyrin repeat and LEM domain containing 2
chicken(416790) ankyrin repeat and LEM domain containing 2
dog(609795) ankyrin repeat and LEM domain containing 2
sheep(101115403) ankyrin repeat and LEM domain containing 2
naked mole-rat(101721686) ankyrin repeat and LEM domain containing 2
domestic guinea pig(100728743) ankyrin repeat and LEM domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015114 Rosetta Predictions human pricing
XM_925991 Rosetta Predictions human pricing
XM_930788 Rosetta Predictions human pricing
XM_930800 Rosetta Predictions human pricing
XM_930810 Rosetta Predictions human pricing
XM_930821 Rosetta Predictions human pricing
XM_930833 Rosetta Predictions human pricing
XM_930843 Rosetta Predictions human pricing
XM_930852 Rosetta Predictions human pricing
XM_930874 Rosetta Predictions human pricing
XM_930881 Rosetta Predictions human pricing
XM_930890 Rosetta Predictions human pricing
XM_930898 Rosetta Predictions human pricing
XM_930904 Rosetta Predictions human pricing
XM_930911 Rosetta Predictions human pricing
XM_930919 Rosetta Predictions human pricing
XM_930927 Rosetta Predictions human pricing
XM_930937 Rosetta Predictions human pricing
NM_001047901 Rosetta Predictions rat pricing
NM_027922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347005 predicted 1117
2 SASI_Hs02_00347006 predicted 908
3 SASI_Hs02_00347007 predicted 538
4 SASI_Hs02_00347008 predicted 322
5 SASI_Hs02_00347009 predicted 802
6 SASI_Hs02_00347010 predicted 1517
7 SASI_Hs02_00347011 predicted 892
8 SASI_Hs02_00347012 predicted 855
9 SASI_Hs02_00347013 predicted 1336
10 SASI_Hs02_00347014 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251967 predicted 1081
2 SASI_Hs01_00251968 predicted 1697
3 SASI_Hs01_00251969 predicted 1160
4 SASI_Hs01_00251970 predicted 1251
5 SASI_Hs01_00251971 predicted 2396
6 SASI_Hs01_00251972 predicted 2582
7 SASI_Hs01_00251973 predicted 2655
8 SASI_Hs01_00251974 predicted 2635
9 SASI_Hs01_00251975 predicted 1037
10 SASI_Hs01_00251976 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266999 predicted 892
2 SASI_Hs01_00267000 predicted 1512
3 SASI_Hs01_00267001 predicted 965
4 SASI_Hs01_00267002 predicted 1056
5 SASI_Hs01_00267003 predicted 2207
6 SASI_Hs01_00267004 predicted 2395
7 SASI_Hs01_00267005 predicted 2473
8 SASI_Hs01_00267006 predicted 2440
9 SASI_Hs01_00267007 predicted 847
10 SASI_Hs01_00267008 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259706 predicted 1079
2 SASI_Hs01_00259707 predicted 1156
3 SASI_Hs01_00259708 predicted 1063
4 SASI_Hs01_00259709 predicted 1138
5 SASI_Hs01_00259710 predicted 1072
6 SASI_Hs01_00259711 predicted 1155
7 SASI_Hs01_00259712 predicted 1133
8 SASI_Hs01_00259713 predicted 1076
9 SASI_Hs01_00259714 predicted 1152
10 SASI_Hs01_00259715 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289810 predicted 1082
2 SASI_Hs01_00289811 predicted 1159
3 SASI_Hs01_00289812 predicted 1248
4 SASI_Hs01_00289813 predicted 1170
5 SASI_Hs01_00289814 predicted 1065
6 SASI_Hs01_00289815 predicted 1219
7 SASI_Hs01_00289816 predicted 1156
8 SASI_Hs01_00289817 predicted 1217
9 SASI_Hs01_00289818 predicted 1155
10 SASI_Hs01_00289819 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282978 predicted 497
2 SASI_Hs01_00282979 predicted 296
3 SASI_Hs01_00282980 predicted 306
4 SASI_Hs01_00282981 predicted 460
5 SASI_Hs01_00282982 predicted 422
6 SASI_Hs01_00282983 predicted 294
7 SASI_Hs01_00282984 predicted 415
8 SASI_Hs01_00282985 predicted 443
9 SASI_Hs01_00282986 predicted 442
10 SASI_Hs01_00282987 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248358 predicted 975
2 SASI_Hs01_00248359 predicted 1589
3 SASI_Hs01_00248360 predicted 1050
4 SASI_Hs01_00248361 predicted 1146
5 SASI_Hs01_00248362 predicted 2287
6 SASI_Hs01_00248363 predicted 2473
7 SASI_Hs01_00248364 predicted 2554
8 SASI_Hs01_00248365 predicted 2528
9 SASI_Hs01_00248366 predicted 926
10 SASI_Hs01_00248367 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283957 predicted 1008
2 SASI_Hs01_00283958 predicted 1629
3 SASI_Hs01_00283959 predicted 1083
4 SASI_Hs01_00283960 predicted 1176
5 SASI_Hs01_00283961 predicted 2326
6 SASI_Hs01_00283962 predicted 2514
7 SASI_Hs01_00283963 predicted 2589
8 SASI_Hs01_00283964 predicted 2559
9 SASI_Hs01_00283965 predicted 962
10 SASI_Hs01_00283966 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260219 predicted 878
2 SASI_Hs01_00260220 predicted 1492
3 SASI_Hs01_00260221 predicted 951
4 SASI_Hs01_00260222 predicted 1052
5 SASI_Hs01_00260223 predicted 2187
6 SASI_Hs01_00260224 predicted 2374
7 SASI_Hs01_00260225 predicted 2450
8 SASI_Hs01_00260226 predicted 2426
9 SASI_Hs01_00260227 predicted 832
10 SASI_Hs01_00260228 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266575 predicted 1085
2 SASI_Hs01_00266576 predicted 1162
3 SASI_Hs01_00266577 predicted 1069
4 SASI_Hs01_00266578 predicted 1138
5 SASI_Hs01_00266579 predicted 1072
6 SASI_Hs01_00266580 predicted 1161
7 SASI_Hs01_00266581 predicted 1134
8 SASI_Hs01_00266582 predicted 1079
9 SASI_Hs01_00266583 predicted 1149
10 SASI_Hs01_00266584 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261075 predicted 1081
2 SASI_Hs01_00261076 predicted 1702
3 SASI_Hs01_00261077 predicted 1162
4 SASI_Hs01_00261078 predicted 1255
5 SASI_Hs01_00261079 predicted 1177
6 SASI_Hs01_00261080 predicted 1696
7 SASI_Hs01_00261081 predicted 1222
8 SASI_Hs01_00261082 predicted 1162
9 SASI_Hs01_00261083 predicted 1220
10 SASI_Hs01_00261084 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293013 predicted 1421
2 SASI_Hs01_00293014 predicted 1490
3 SASI_Hs01_00293015 predicted 1500
4 SASI_Hs01_00293016 predicted 1490
5 SASI_Hs01_00293017 predicted 1466
6 SASI_Hs01_00293018 predicted 1566
7 SASI_Hs01_00293019 predicted 1425
8 SASI_Hs01_00293020 predicted 1425
9 SASI_Hs01_00293021 predicted 1511
10 SASI_Hs01_00293022 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262583 predicted 2190
2 SASI_Hs01_00262584 predicted 2262
3 SASI_Hs01_00262585 predicted 2263
4 SASI_Hs01_00262586 predicted 2267
5 SASI_Hs01_00262587 predicted 2239
6 SASI_Hs01_00262588 predicted 2339
7 SASI_Hs01_00262589 predicted 2198
8 SASI_Hs01_00262590 predicted 2194
9 SASI_Hs01_00262591 predicted 2286
10 SASI_Hs01_00262592 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276593 predicted 1084
2 SASI_Hs01_00276594 predicted 1163
3 SASI_Hs01_00276595 predicted 1248
4 SASI_Hs01_00276596 predicted 1035
5 SASI_Hs01_00276597 predicted 1215
6 SASI_Hs01_00276598 predicted 1158
7 SASI_Hs01_00276599 predicted 1073
8 SASI_Hs01_00276600 predicted 874
9 SASI_Hs01_00276601 predicted 505
10 SASI_Hs01_00276602 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281684 predicted 2068
2 SASI_Hs01_00281685 predicted 2143
3 SASI_Hs01_00281686 predicted 2140
4 SASI_Hs01_00281687 predicted 2146
5 SASI_Hs01_00281688 predicted 2120
6 SASI_Hs01_00281689 predicted 2213
7 SASI_Hs01_00281690 predicted 2075
8 SASI_Hs01_00281691 predicted 2066
9 SASI_Hs01_00281692 predicted 2159
10 SASI_Hs01_00281693 predicted 2033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272041 predicted 2035
2 SASI_Hs01_00272042 predicted 2114
3 SASI_Hs01_00272043 predicted 2114
4 SASI_Hs01_00272044 predicted 2112
5 SASI_Hs01_00272045 predicted 2090
6 SASI_Hs01_00272046 predicted 2186
7 SASI_Hs01_00272047 predicted 2041
8 SASI_Hs01_00272048 predicted 2044
9 SASI_Hs01_00272049 predicted 2136
10 SASI_Hs01_00272050 predicted 2003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256876 predicted 1079
2 SASI_Hs01_00256877 predicted 1703
3 SASI_Hs01_00256878 predicted 1162
4 SASI_Hs01_00256879 predicted 1247
5 SASI_Hs01_00256880 predicted 2400
6 SASI_Hs01_00256881 predicted 2576
7 SASI_Hs01_00256882 predicted 2631
8 SASI_Hs01_00256883 predicted 1029
9 SASI_Hs01_00256884 predicted 1222
10 SASI_Hs01_00256885 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284507 predicted 1085
2 SASI_Hs01_00284508 predicted 1702
3 SASI_Hs01_00284509 predicted 1163
4 SASI_Hs01_00284510 predicted 1249
5 SASI_Hs01_00284511 predicted 1172
6 SASI_Hs01_00284512 predicted 1702
7 SASI_Hs01_00284513 predicted 1213
8 SASI_Hs01_00284514 predicted 1161
9 SASI_Hs01_00284515 predicted 1220
10 SASI_Hs01_00284516 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206627 predicted 242
2 SASI_Rn02_00206628 predicted 1470
3 SASI_Rn02_00206629 predicted 801
4 SASI_Rn02_00206630 predicted 1891
5 SASI_Rn02_00206631 predicted 525
6 SASI_Rn02_00206632 predicted 2369
7 SASI_Rn02_00206633 predicted 1290
8 SASI_Rn02_00206634 predicted 437
9 SASI_Rn02_00206635 predicted 1051
10 SASI_Rn02_00206636 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084455 predicted 1626
2 SASI_Mm01_00084456 predicted 2894
3 SASI_Mm01_00084457 predicted 460
4 SASI_Mm02_00332902 predicted 393
5 SASI_Mm01_00084458 predicted 784
6 SASI_Mm01_00084459 predicted 3087
7 SASI_Mm01_00084460 predicted 888
8 SASI_Mm01_00084461 predicted 1617
9 SASI_Mm01_00084462 predicted 953
10 SASI_Mm01_00084463 predicted 2280
11 SASI_Mm01_00084464 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027922
VALIDATED
ANKLE2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and LEM domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3297s21c1
Sequence:CCGGTGAAAGTGTAGCCGTAATAATCTCGAGATTATTACGGCTACACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-862s21c1
Sequence:CCGGGATCCATGTTTACGAAGATAACTCGAGTTATCTTCGTAAACATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-2774s21c1
Sequence:CCGGGCTCTTGAGTGTGCGAATATTCTCGAGAATATTCGCACACTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-815s21c1
Sequence:CCGGTATGGAGTGTGTCCAGTATATCTCGAGATATACTGGACACACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3094s21c1
Sequence:CCGGGCTTACTCCTGGGATTCATTTCTCGAGAAATGAATCCCAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027922.1-4748s1c1
Sequence:CCGGCCACACACTATATTCAGCTATCTCGAGATAGCTGAATATAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1562s1c1
Sequence:CCGGCCTGAAGAAGTAATTTGTGAACTCGAGTTCACAAATTACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-410s1c1
Sequence:CCGGGCTCGACTGAAACTCTTGAATCTCGAGATTCAAGAGTTTCAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1941s1c1
Sequence:CCGGCCTGGGTTGAATACTGGGAATCTCGAGATTCCCAGTATTCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1942s1c1
Sequence:CCGGCTGGGTTGAATACTGGGAATTCTCGAGAATTCCCAGTATTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027922
VALIDATED
ANKLE2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and LEM domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3297s21c1
Sequence:CCGGTGAAAGTGTAGCCGTAATAATCTCGAGATTATTACGGCTACACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-862s21c1
Sequence:CCGGGATCCATGTTTACGAAGATAACTCGAGTTATCTTCGTAAACATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-2774s21c1
Sequence:CCGGGCTCTTGAGTGTGCGAATATTCTCGAGAATATTCGCACACTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-815s21c1
Sequence:CCGGTATGGAGTGTGTCCAGTATATCTCGAGATATACTGGACACACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3094s21c1
Sequence:CCGGGCTTACTCCTGGGATTCATTTCTCGAGAAATGAATCCCAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027922.1-4748s1c1
Sequence:CCGGCCACACACTATATTCAGCTATCTCGAGATAGCTGAATATAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1562s1c1
Sequence:CCGGCCTGAAGAAGTAATTTGTGAACTCGAGTTCACAAATTACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-410s1c1
Sequence:CCGGGCTCGACTGAAACTCTTGAATCTCGAGATTCAAGAGTTTCAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1941s1c1
Sequence:CCGGCCTGGGTTGAATACTGGGAATCTCGAGATTCCCAGTATTCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1942s1c1
Sequence:CCGGCTGGGTTGAATACTGGGAATTCTCGAGAATTCCCAGTATTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027922
VALIDATED
ANKLE2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and LEM domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3297s21c1
Sequence:CCGGTGAAAGTGTAGCCGTAATAATCTCGAGATTATTACGGCTACACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-862s21c1
Sequence:CCGGGATCCATGTTTACGAAGATAACTCGAGTTATCTTCGTAAACATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-2774s21c1
Sequence:CCGGGCTCTTGAGTGTGCGAATATTCTCGAGAATATTCGCACACTCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027922.1-815s21c1
Sequence:CCGGTATGGAGTGTGTCCAGTATATCTCGAGATATACTGGACACACTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027922.1-3094s21c1
Sequence:CCGGGCTTACTCCTGGGATTCATTTCTCGAGAAATGAATCCCAGGAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027922.1-4748s1c1
Sequence:CCGGCCACACACTATATTCAGCTATCTCGAGATAGCTGAATATAGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1562s1c1
Sequence:CCGGCCTGAAGAAGTAATTTGTGAACTCGAGTTCACAAATTACTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-410s1c1
Sequence:CCGGGCTCGACTGAAACTCTTGAATCTCGAGATTCAAGAGTTTCAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1941s1c1
Sequence:CCGGCCTGGGTTGAATACTGGGAATCTCGAGATTCCCAGTATTCAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027922.1-1942s1c1
Sequence:CCGGCTGGGTTGAATACTGGGAATTCTCGAGAATTCCCAGTATTCAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015114
VALIDATED
ANKLE2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and LEM domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1463s21c1
Sequence:CCGGGAGCGGATCAGAGAGTATTTACTCGAGTAAATACTCTCTGATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-1363s21c1
Sequence:CCGGGTCACACCATTTGATTGTAAACTCGAGTTTACAATCAAATGGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015114.1-3478s21c1
Sequence:CCGGATTTGGGTTGTTCGGAATATTCTCGAGAATATTCCGAACAACCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1300s21c1
Sequence:CCGGCTATGACACACCGTTGCATTTCTCGAGAAATGCAACGGTGTGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-2447s21c1
Sequence:CCGGATGTCAGCCAGGATCGCTAAACTCGAGTTTAGCGATCCTGGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015114
VALIDATED
ANKLE2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and LEM domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1463s21c1
Sequence:CCGGGAGCGGATCAGAGAGTATTTACTCGAGTAAATACTCTCTGATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-1363s21c1
Sequence:CCGGGTCACACCATTTGATTGTAAACTCGAGTTTACAATCAAATGGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015114.1-3478s21c1
Sequence:CCGGATTTGGGTTGTTCGGAATATTCTCGAGAATATTCCGAACAACCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1300s21c1
Sequence:CCGGCTATGACACACCGTTGCATTTCTCGAGAAATGCAACGGTGTGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-2447s21c1
Sequence:CCGGATGTCAGCCAGGATCGCTAAACTCGAGTTTAGCGATCCTGGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015114
VALIDATED
ANKLE2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and LEM domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1463s21c1
Sequence:CCGGGAGCGGATCAGAGAGTATTTACTCGAGTAAATACTCTCTGATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-1363s21c1
Sequence:CCGGGTCACACCATTTGATTGTAAACTCGAGTTTACAATCAAATGGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015114.1-3478s21c1
Sequence:CCGGATTTGGGTTGTTCGGAATATTCTCGAGAATATTCCGAACAACCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015114.1-1300s21c1
Sequence:CCGGCTATGACACACCGTTGCATTTCTCGAGAAATGCAACGGTGTGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015114.1-2447s21c1
Sequence:CCGGATGTCAGCCAGGATCGCTAAACTCGAGTTTAGCGATCCTGGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks