EMAIL THIS PAGE TO A FRIEND

ANKMY1

ankyrin repeat and MYND domain containing 1

59 Gene Product Result for
Synonyms: ZMYND13
Gene ID:
Mouse(241158) ankyrin repeat and MYND domain containing 1
Rat(684015) ankyrin repeat and MYND domain containing 1
domestic guinea pig(100733901) ankyrin repeat and MYND domain containing 1
naked mole-rat(101706246) ankyrin repeat and MYND domain containing 1
sheep(101104451) ankyrin repeat and MYND domain containing 1
Zebrafish(568987) ankyrin repeat and MYND domain containing 1
dog(486198) ankyrin repeat and MYND domain containing 1
cow(538124) ankyrin repeat and MYND domain containing 1
domestic cat(101094366) ankyrin repeat and MYND domain containing 1
chicken(417300) ankyrin repeat and MYND domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016552 Rosetta Predictions human pricing
NM_017844 Rosetta Predictions human pricing
XM_001068522 Rosetta Predictions rat pricing
NM_172850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183310 predicted 2567
2 SASI_Hs01_00183312 predicted 1604
3 SASI_Hs02_00349671 predicted 1564
4 SASI_Hs01_00183313 predicted 2938
5 SASI_Hs01_00183314 predicted 1603
6 SASI_Hs01_00183316 predicted 1415
7 SASI_Hs01_00183318 predicted 1612
8 SASI_Hs01_00183319 predicted 3008
9 SASI_Hs02_00349672 predicted 1859
10 SASI_Hs02_00349673 predicted 1649
11 SASI_Hs01_00183311 predicted 2843
12 SASI_Hs01_00183315 predicted 1765
13 SASI_Hs01_00183317 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196971 predicted 1792
2 SASI_Hs01_00196973 predicted 1075
3 SASI_Hs02_00350736 predicted 1043
4 SASI_Hs01_00196974 predicted 2159
5 SASI_Hs01_00196975 predicted 1068
6 SASI_Hs01_00196977 predicted 888
7 SASI_Hs01_00196979 predicted 1086
8 SASI_Hs01_00196980 predicted 2227
9 SASI_Hs02_00350737 predicted 1332
10 SASI_Hs02_00350738 predicted 1120
11 SASI_Hs01_00196972 predicted 2067
12 SASI_Hs01_00196976 predicted 1245
13 SASI_Hs01_00196978 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324795 predicted 1642
2 SASI_Rn02_00324796 predicted 3033
3 SASI_Rn02_00324797 predicted 2493
4 SASI_Rn02_00324798 predicted 1032
5 SASI_Rn02_00324799 predicted 1509
6 SASI_Rn02_00324800 predicted 2795
7 SASI_Rn02_00324801 predicted 2326
8 SASI_Rn02_00324802 predicted 381
9 SASI_Rn02_00324803 predicted 2358
10 SASI_Rn02_00324804 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344795 predicted 1354
2 SASI_Mm01_00113265 predicted 1017
3 SASI_Mm01_00113266 predicted 1567
4 SASI_Mm01_00113267 predicted 1471
5 SASI_Mm01_00113268 predicted 2396
6 SASI_Mm01_00113269 predicted 2698
7 SASI_Mm01_00113270 predicted 1856
8 SASI_Mm01_00113272 predicted 859
9 SASI_Mm01_00113273 predicted 389
10 SASI_Mm01_00113274 predicted 1719
11 SASI_Mm01_00113271 predicted 3015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172850
ANKMY1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and MYND domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-3030s1c1
Sequence:CCGGGAAGGACTGCAACGACATCATCTCGAGATGATGTCGTTGCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1023s1c1
Sequence:CCGGGCAAACTTACAAGTTCAGGAACTCGAGTTCCTGAACTTGTAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1017s1c1
Sequence:CCGGCCAGAAGCAAACTTACAAGTTCTCGAGAACTTGTAAGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-2131s1c1
Sequence:CCGGGACGAGGACTACGTGTACAAACTCGAGTTTGTACACGTAGTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1857s1c1
Sequence:CCGGCCGTTGGATGACCATCACATTCTCGAGAATGTGATGGTCATCCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172850
ANKMY1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and MYND domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-3030s1c1
Sequence:CCGGGAAGGACTGCAACGACATCATCTCGAGATGATGTCGTTGCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1023s1c1
Sequence:CCGGGCAAACTTACAAGTTCAGGAACTCGAGTTCCTGAACTTGTAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1017s1c1
Sequence:CCGGCCAGAAGCAAACTTACAAGTTCTCGAGAACTTGTAAGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-2131s1c1
Sequence:CCGGGACGAGGACTACGTGTACAAACTCGAGTTTGTACACGTAGTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1857s1c1
Sequence:CCGGCCGTTGGATGACCATCACATTCTCGAGAATGTGATGGTCATCCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172850
ANKMY1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and MYND domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-3030s1c1
Sequence:CCGGGAAGGACTGCAACGACATCATCTCGAGATGATGTCGTTGCAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1023s1c1
Sequence:CCGGGCAAACTTACAAGTTCAGGAACTCGAGTTCCTGAACTTGTAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1017s1c1
Sequence:CCGGCCAGAAGCAAACTTACAAGTTCTCGAGAACTTGTAAGTTTGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-2131s1c1
Sequence:CCGGGACGAGGACTACGTGTACAAACTCGAGTTTGTACACGTAGTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172850.1-1857s1c1
Sequence:CCGGCCGTTGGATGACCATCACATTCTCGAGAATGTGATGGTCATCCAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017844
ANKMY1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and MYND domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-422s1c1
Sequence:CCGGGAAGCTTGGATATGGCAAATTCTCGAGAATTTGCCATATCCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-413s1c1
Sequence:CCGGGTTGAACATGAAGCTTGGATACTCGAGTATCCAAGCTTCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-656s1c1
Sequence:CCGGCGTGAACAAGTGCTCAGATGACTCGAGTCATCTGAGCACTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-1797s1c1
Sequence:CCGGGTGGACTATGGCTACTTCAGACTCGAGTCTGAAGTAGCCATAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-796s21c1
Sequence:CCGGCAATCCTTTCATCATCATTTACTCGAGTAAATGATGATGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-607s21c1
Sequence:CCGGCTCACTGCCACAACGACATTGCTCGAGCAATGTCGTTGTGGCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017844
ANKMY1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and MYND domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-422s1c1
Sequence:CCGGGAAGCTTGGATATGGCAAATTCTCGAGAATTTGCCATATCCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-413s1c1
Sequence:CCGGGTTGAACATGAAGCTTGGATACTCGAGTATCCAAGCTTCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-656s1c1
Sequence:CCGGCGTGAACAAGTGCTCAGATGACTCGAGTCATCTGAGCACTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-1797s1c1
Sequence:CCGGGTGGACTATGGCTACTTCAGACTCGAGTCTGAAGTAGCCATAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-796s21c1
Sequence:CCGGCAATCCTTTCATCATCATTTACTCGAGTAAATGATGATGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-607s21c1
Sequence:CCGGCTCACTGCCACAACGACATTGCTCGAGCAATGTCGTTGTGGCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017844
ANKMY1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and MYND domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-422s1c1
Sequence:CCGGGAAGCTTGGATATGGCAAATTCTCGAGAATTTGCCATATCCAAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-413s1c1
Sequence:CCGGGTTGAACATGAAGCTTGGATACTCGAGTATCCAAGCTTCATGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-656s1c1
Sequence:CCGGCGTGAACAAGTGCTCAGATGACTCGAGTCATCTGAGCACTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017844.1-1797s1c1
Sequence:CCGGGTGGACTATGGCTACTTCAGACTCGAGTCTGAAGTAGCCATAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-796s21c1
Sequence:CCGGCAATCCTTTCATCATCATTTACTCGAGTAAATGATGATGAAAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017844.2-607s21c1
Sequence:CCGGCTCACTGCCACAACGACATTGCTCGAGCAATGTCGTTGTGGCAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks