EMAIL THIS PAGE TO A FRIEND

ANKMY2

ankyrin repeat and MYND domain containing 2

106 Gene Product Result for
Synonyms: ZMYND20
UniProtKB ID: Q8IV38, A4D124, Q659G1, Q96BL3
Gene ID:
Mouse(217473) ankyrin repeat and MYND domain containing 2
Rat(314046) ankyrin repeat and MYND domain containing 2
chicken(420593) ankyrin repeat and MYND domain containing 2
cow(509032) ankyrin repeat and MYND domain containing 2
Horse(100052981) ankyrin repeat and MYND domain containing 2
domestic cat(101092755) ankyrin repeat and MYND domain containing 2
dog(475249) ankyrin repeat and MYND domain containing 2
sheep(101104569) ankyrin repeat and MYND domain containing 2
naked mole-rat(101711362) ankyrin repeat and MYND domain containing 2
domestic guinea pig(100713370) ankyrin repeat and MYND domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020319 Rosetta Predictions human pricing
NM_001108019 Rosetta Predictions rat pricing
NM_146033 Rosetta Predictions mouse pricing
NM_178910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179310 predicted 281
2 SASI_Hs02_00353242 predicted 1219
3 SASI_Hs01_00179311 predicted 440
4 SASI_Hs01_00179313 predicted 422
5 SASI_Hs01_00179315 predicted 1102
6 SASI_Hs02_00353243 predicted 1347
7 SASI_Hs01_00179317 predicted 847
8 SASI_Hs02_00353244 predicted 260
9 SASI_Hs01_00179318 predicted 295
10 SASI_Hs01_00179319 predicted 1341
11 SASI_Hs01_00179312 predicted 1065
12 SASI_Hs01_00179314 predicted 1081
13 SASI_Hs01_00179316 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234565 predicted 1111
2 SASI_Rn02_00234566 predicted 429
3 SASI_Rn02_00234567 predicted 548
4 SASI_Rn02_00234568 predicted 1132
5 SASI_Rn02_00234569 predicted 297
6 SASI_Rn02_00234570 predicted 1241
7 SASI_Rn02_00234571 predicted 711
8 SASI_Rn02_00234572 predicted 858
9 SASI_Rn02_00234573 predicted 422
10 SASI_Rn02_00234574 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341617 predicted 271
2 SASI_Mm02_00341618 predicted 261
3 SASI_Mm02_00341619 predicted 250
4 SASI_Mm02_00341620 predicted 321
5 SASI_Mm02_00341621 predicted 218
6 SASI_Mm02_00341622 predicted 402
7 SASI_Mm01_00020769 predicted 280
8 SASI_Mm02_00341623 predicted 246
9 SASI_Mm02_00341624 predicted 364
10 SASI_Mm02_00341625 predicted 410
11 SASI_Mm01_00020763 predicted 1226
12 SASI_Mm01_00020764 predicted 1232
13 SASI_Mm01_00020765 predicted 865
14 SASI_Mm01_00020766 predicted 1238
15 SASI_Mm01_00020767 predicted 1053
16 SASI_Mm01_00020768 predicted 1253
17 SASI_Mm01_00020770 predicted 689
18 SASI_Mm01_00020771 predicted 673
19 SASI_Mm01_00020772 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349520 predicted 274
2 SASI_Mm01_00073942 predicted 264
3 SASI_Mm01_00073944 predicted 244
4 SASI_Mm01_00073945 predicted 326
5 SASI_Mm01_00073948 predicted 214
6 SASI_Mm02_00349521 predicted 399
7 SASI_Mm02_00349522 predicted 279
8 SASI_Mm02_00349523 predicted 250
9 SASI_Mm02_00349524 predicted 365
10 SASI_Mm02_00349525 predicted 411
11 SASI_Mm01_00073943 predicted 864
12 SASI_Mm01_00073946 predicted 1116
13 SASI_Mm01_00073947 predicted 908
14 SASI_Mm01_00073949 predicted 1029
15 SASI_Mm01_00073950 predicted 1131
16 SASI_Mm01_00073951 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020319
ANKMY2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and MYND domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-802s21c1
Sequence:CCGGTGGATTTGATTTGTGAGAAATCTCGAGATTTCTCACAAATCAAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1242s21c1
Sequence:CCGGACACACTGGTTTACTCATAAGCTCGAGCTTATGAGTAAACCAGTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-576s21c1
Sequence:CCGGCATGATTGTGTGACCATAATCCTCGAGGATTATGGTCACACAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1270s21c1
Sequence:CCGGGTAAGAATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020319.1-1675s21c1
Sequence:CCGGTGTTGACCATGCCCTAATTTCCTCGAGGAAATTAGGGCATGGTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1211s21c1
Sequence:CCGGGGTAATATATTGTGATCAAACCTCGAGGTTTGATCACAATATATTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-301s1c1
Sequence:CCGGGCAAGAATGTTCGTGTCAACTCTCGAGAGTTGACACGAACATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020319.1-2041s1c1
Sequence:CCGGCCTTTGCCATAGTTCAGCTAACTCGAGTTAGCTGAACTATGGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-1392s1c1
Sequence:CCGGGCTGAAGTAGGTATCTCTCAACTCGAGTTGAGAGATACCTACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-345s1c1
Sequence:CCGGCCTCTAATGCATGCAGCATATCTCGAGATATGCTGCATGCATTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020319.1-275s1c1
Sequence:CCGGCCAAGAAGCTGGAACATTATTCTCGAGAATAATGTTCCAGCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-973s1c1
Sequence:CCGGGCTTTCCAGTGTATCAAGAAACTCGAGTTTCTTGATACACTGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020319
ANKMY2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and MYND domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-802s21c1
Sequence:CCGGTGGATTTGATTTGTGAGAAATCTCGAGATTTCTCACAAATCAAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1242s21c1
Sequence:CCGGACACACTGGTTTACTCATAAGCTCGAGCTTATGAGTAAACCAGTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-576s21c1
Sequence:CCGGCATGATTGTGTGACCATAATCCTCGAGGATTATGGTCACACAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1270s21c1
Sequence:CCGGGTAAGAATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020319.1-1675s21c1
Sequence:CCGGTGTTGACCATGCCCTAATTTCCTCGAGGAAATTAGGGCATGGTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1211s21c1
Sequence:CCGGGGTAATATATTGTGATCAAACCTCGAGGTTTGATCACAATATATTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-301s1c1
Sequence:CCGGGCAAGAATGTTCGTGTCAACTCTCGAGAGTTGACACGAACATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020319.1-2041s1c1
Sequence:CCGGCCTTTGCCATAGTTCAGCTAACTCGAGTTAGCTGAACTATGGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-1392s1c1
Sequence:CCGGGCTGAAGTAGGTATCTCTCAACTCGAGTTGAGAGATACCTACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-345s1c1
Sequence:CCGGCCTCTAATGCATGCAGCATATCTCGAGATATGCTGCATGCATTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020319.1-275s1c1
Sequence:CCGGCCAAGAAGCTGGAACATTATTCTCGAGAATAATGTTCCAGCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-973s1c1
Sequence:CCGGGCTTTCCAGTGTATCAAGAAACTCGAGTTTCTTGATACACTGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020319
ANKMY2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and MYND domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-802s21c1
Sequence:CCGGTGGATTTGATTTGTGAGAAATCTCGAGATTTCTCACAAATCAAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1242s21c1
Sequence:CCGGACACACTGGTTTACTCATAAGCTCGAGCTTATGAGTAAACCAGTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-576s21c1
Sequence:CCGGCATGATTGTGTGACCATAATCCTCGAGGATTATGGTCACACAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1270s21c1
Sequence:CCGGGTAAGAATCTGAAGGACATTTCTCGAGAAATGTCCTTCAGATTCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020319.1-1675s21c1
Sequence:CCGGTGTTGACCATGCCCTAATTTCCTCGAGGAAATTAGGGCATGGTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020319.1-1211s21c1
Sequence:CCGGGGTAATATATTGTGATCAAACCTCGAGGTTTGATCACAATATATTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-301s1c1
Sequence:CCGGGCAAGAATGTTCGTGTCAACTCTCGAGAGTTGACACGAACATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020319.1-2041s1c1
Sequence:CCGGCCTTTGCCATAGTTCAGCTAACTCGAGTTAGCTGAACTATGGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-1392s1c1
Sequence:CCGGGCTGAAGTAGGTATCTCTCAACTCGAGTTGAGAGATACCTACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-345s1c1
Sequence:CCGGCCTCTAATGCATGCAGCATATCTCGAGATATGCTGCATGCATTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020319.1-275s1c1
Sequence:CCGGCCAAGAAGCTGGAACATTATTCTCGAGAATAATGTTCCAGCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020319.1-973s1c1
Sequence:CCGGGCTTTCCAGTGTATCAAGAAACTCGAGTTTCTTGATACACTGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146033
VALIDATED
ANKMY2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and MYND domain containing 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-586s1c1
Sequence:CCGGGACTGGATTATTACACTAAACCTCGAGGTTTAGTGTAATAATCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1644s21c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146033.2-2218s21c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-251s21c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1338s21c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146033.2-857s21c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-981s1c1
Sequence:CCGGCGGAAGTTTCCATACTGTGAACTCGAGTTCACAGTATGGAAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-251s1c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-321s1c1
Sequence:CCGGCATGCAGCCTATAAAGGGAAACTCGAGTTTCCCTTTATAGGCTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-857s1c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1644s1c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1338s1c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-2218s1c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146033
VALIDATED
ANKMY2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and MYND domain containing 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-586s1c1
Sequence:CCGGGACTGGATTATTACACTAAACCTCGAGGTTTAGTGTAATAATCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1644s21c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146033.2-2218s21c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-251s21c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1338s21c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146033.2-857s21c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-981s1c1
Sequence:CCGGCGGAAGTTTCCATACTGTGAACTCGAGTTCACAGTATGGAAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-251s1c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-321s1c1
Sequence:CCGGCATGCAGCCTATAAAGGGAAACTCGAGTTTCCCTTTATAGGCTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-857s1c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1644s1c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1338s1c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-2218s1c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146033
VALIDATED
ANKMY2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and MYND domain containing 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-586s1c1
Sequence:CCGGGACTGGATTATTACACTAAACCTCGAGGTTTAGTGTAATAATCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1644s21c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146033.2-2218s21c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-251s21c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146033.2-1338s21c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146033.2-857s21c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-981s1c1
Sequence:CCGGCGGAAGTTTCCATACTGTGAACTCGAGTTCACAGTATGGAAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-251s1c1
Sequence:CCGGCGGAAGACTGTTGTCTAGTAACTCGAGTTACTAGACAACAGTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146033.2-321s1c1
Sequence:CCGGCATGCAGCCTATAAAGGGAAACTCGAGTTTCCCTTTATAGGCTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-857s1c1
Sequence:CCGGGAAATGCATTACCTTCCTCAACTCGAGTTGAGGAAGGTAATGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1644s1c1
Sequence:CCGGCCGTCTTGATTTCCTGTTGATCTCGAGATCAACAGGAAATCAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-1338s1c1
Sequence:CCGGGTCAATGAAGATCAACCAGAACTCGAGTTCTGGTTGATCTTCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146033.2-2218s1c1
Sequence:CCGGCCTATCCAGAAACTGTGATTTCTCGAGAAATCACAGTTTCTGGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)