EMAIL THIS PAGE TO A FRIEND

ANKRA2

ankyrin repeat, family A (RFXANK-like), 2

73 Gene Product Result for
Synonyms: ANKRA
UniProtKB ID: Q9H9E1
Gene ID:
Mouse(68558) ankyrin repeat, family A (RFXANK-like), 2
Rat(294679) ankyrin repeat, family A (RFXANK-like), 2
Zebrafish(406403) ankyrin repeat, family A (RFXANK-like), 2
chicken(426153) ankyrin repeat, family A (RFXANK-like), 2
dog(478097) ankyrin repeat, family A (RFXANK-like), 2
cow(528003) ankyrin repeat, family A (RFXANK-like), 2
domestic cat(101093661) ankyrin repeat, family A (RFXANK-like), 2
domestic guinea pig(100733458) ankyrin repeat, family A (RFXANK-like), 2
naked mole-rat(101712179) ankyrin repeat, family A (RFXANK-like), 2
sheep(101113362) ankyrin repeat, family A (RFXANK-like), 2
Domestic Rabbit(100340097) ankyrin repeat, family A (RFXANK-like), 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023039 Rosetta Predictions human pricing
NM_207595 Rosetta Predictions rat pricing
NM_023472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219632 predicted 837
2 SASI_Hs01_00219634 predicted 1538
3 SASI_Hs01_00219635 predicted 920
4 SASI_Hs02_00356304 predicted 852
5 SASI_Hs01_00219636 predicted 1500
6 SASI_Hs01_00219637 predicted 830
7 SASI_Hs01_00219638 predicted 1486
8 SASI_Hs01_00219640 predicted 838
9 SASI_Hs01_00219641 predicted 1522
10 SASI_Hs02_00356305 predicted 1414
11 SASI_Hs01_00219633 predicted 1326
12 SASI_Hs01_00219639 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048854 predicted 490
2 SASI_Rn01_00048855 predicted 1037
3 SASI_Rn01_00048856 predicted 646
4 SASI_Rn01_00048857 predicted 856
5 SASI_Rn01_00048858 predicted 793
6 SASI_Rn01_00048859 predicted 552
7 SASI_Rn01_00048860 predicted 924
8 SASI_Rn01_00048861 predicted 593
9 SASI_Rn01_00048862 predicted 1055
10 SASI_Rn01_00048863 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152779 predicted 1151
2 SASI_Mm01_00152780 predicted 510
3 SASI_Mm01_00152781 predicted 656
4 SASI_Mm01_00152782 predicted 530
5 SASI_Mm01_00152783 predicted 896
6 SASI_Mm01_00152784 predicted 714
7 SASI_Mm01_00152785 predicted 599
8 SASI_Mm01_00152786 predicted 700
9 SASI_Mm01_00152787 predicted 661
10 SASI_Mm01_00152788 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023039
VALIDATED
ANKRA2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat, family A (RFXANK-like), 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023039.2-1898s1c1
Sequence:CCGGCTAGTCATCTTCACTCGTGTACTCGAGTACACGAGTGAAGATGACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1075s1c1
Sequence:CCGGCCACACCTCTGTTAGCAAATTCTCGAGAATTTGCTAACAGAGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023039.2-1144s1c1
Sequence:CCGGCTACTCGTATCGAACAAGAAACTCGAGTTTCTTGTTCGATACGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023039.2-943s1c1
Sequence:CCGGGCAATATCCATACATCTCCTTCTCGAGAAGGAGATGTATGGATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023039.2-1536s1c1
Sequence:CCGGCAACAGGTTATTGAGTCACATCTCGAGATGTGACTCAATAACCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1078s1c1
Sequence:CCGGCACCTCTGTTAGCAAATTCTTCTCGAGAAGAATTTGCTAACAGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023039.2-1720s1c1
Sequence:CCGGCTCTGAGTAATTCACTGGTTTCTCGAGAAACCAGTGAATTACTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1526s21c1
Sequence:CCGGAGAAGTGTTCAACAGGTTATTCTCGAGAATAACCTGTTGAACACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1302s21c1
Sequence:CCGGTGTCGTTGGCCTGTAGTAAAGCTCGAGCTTTACTACAGGCCAACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1621s21c1
Sequence:CCGGTTACTTCTTGGTCCTTATAAACTCGAGTTTATAAGGACCAAGAAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-912s21c1
Sequence:CCGGAGGTGGCATCTGTCCTATTTACTCGAGTAAATAGGACAGATGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1475s21c1
Sequence:CCGGGAAACTGACTCTGGATATAATCTCGAGATTATATCCAGAGTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023039
VALIDATED
ANKRA2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat, family A (RFXANK-like), 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023039.2-1898s1c1
Sequence:CCGGCTAGTCATCTTCACTCGTGTACTCGAGTACACGAGTGAAGATGACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1075s1c1
Sequence:CCGGCCACACCTCTGTTAGCAAATTCTCGAGAATTTGCTAACAGAGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023039.2-1144s1c1
Sequence:CCGGCTACTCGTATCGAACAAGAAACTCGAGTTTCTTGTTCGATACGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023039.2-943s1c1
Sequence:CCGGGCAATATCCATACATCTCCTTCTCGAGAAGGAGATGTATGGATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023039.2-1536s1c1
Sequence:CCGGCAACAGGTTATTGAGTCACATCTCGAGATGTGACTCAATAACCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1078s1c1
Sequence:CCGGCACCTCTGTTAGCAAATTCTTCTCGAGAAGAATTTGCTAACAGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023039.2-1720s1c1
Sequence:CCGGCTCTGAGTAATTCACTGGTTTCTCGAGAAACCAGTGAATTACTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1526s21c1
Sequence:CCGGAGAAGTGTTCAACAGGTTATTCTCGAGAATAACCTGTTGAACACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1302s21c1
Sequence:CCGGTGTCGTTGGCCTGTAGTAAAGCTCGAGCTTTACTACAGGCCAACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1621s21c1
Sequence:CCGGTTACTTCTTGGTCCTTATAAACTCGAGTTTATAAGGACCAAGAAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-912s21c1
Sequence:CCGGAGGTGGCATCTGTCCTATTTACTCGAGTAAATAGGACAGATGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1475s21c1
Sequence:CCGGGAAACTGACTCTGGATATAATCTCGAGATTATATCCAGAGTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023039
VALIDATED
ANKRA2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat, family A (RFXANK-like), 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023039.2-1898s1c1
Sequence:CCGGCTAGTCATCTTCACTCGTGTACTCGAGTACACGAGTGAAGATGACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1075s1c1
Sequence:CCGGCCACACCTCTGTTAGCAAATTCTCGAGAATTTGCTAACAGAGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023039.2-1144s1c1
Sequence:CCGGCTACTCGTATCGAACAAGAAACTCGAGTTTCTTGTTCGATACGAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023039.2-943s1c1
Sequence:CCGGGCAATATCCATACATCTCCTTCTCGAGAAGGAGATGTATGGATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023039.2-1536s1c1
Sequence:CCGGCAACAGGTTATTGAGTCACATCTCGAGATGTGACTCAATAACCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_023039.2-1078s1c1
Sequence:CCGGCACCTCTGTTAGCAAATTCTTCTCGAGAAGAATTTGCTAACAGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151847    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023039.2-1720s1c1
Sequence:CCGGCTCTGAGTAATTCACTGGTTTCTCGAGAAACCAGTGAATTACTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1526s21c1
Sequence:CCGGAGAAGTGTTCAACAGGTTATTCTCGAGAATAACCTGTTGAACACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1302s21c1
Sequence:CCGGTGTCGTTGGCCTGTAGTAAAGCTCGAGCTTTACTACAGGCCAACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_023039.3-1621s21c1
Sequence:CCGGTTACTTCTTGGTCCTTATAAACTCGAGTTTATAAGGACCAAGAAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-912s21c1
Sequence:CCGGAGGTGGCATCTGTCCTATTTACTCGAGTAAATAGGACAGATGCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023039.3-1475s21c1
Sequence:CCGGGAAACTGACTCTGGATATAATCTCGAGATTATATCCAGAGTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023472
VALIDATED
ANKRA2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat, family A (RFXANK-like), 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-517s1c1
Sequence:CCGGCGTGTGTTCTCGATTCGTGAACTCGAGTTCACGAATCGAGAACACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023472.1-1048s1c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-824s1c1
Sequence:CCGGGCTACTCGTATTGAACAAGAACTCGAGTTCTTGTTCAATACGAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-753s1c1
Sequence:CCGGCTACCACACCTCTGTTAGCAACTCGAGTTGCTAACAGAGGTGTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-1421s1c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-496s1c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023472.1-1421s21c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1048s21c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-496s21c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-527s21c1
Sequence:CCGGCGATTCGTGAAGTCCTTAAATCTCGAGATTTAAGGACTTCACGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1157s21c1
Sequence:CCGGGAAACAGACTCTGGCTATAATCTCGAGATTATAGCCAGAGTCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023472
VALIDATED
ANKRA2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat, family A (RFXANK-like), 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-517s1c1
Sequence:CCGGCGTGTGTTCTCGATTCGTGAACTCGAGTTCACGAATCGAGAACACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023472.1-1048s1c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-824s1c1
Sequence:CCGGGCTACTCGTATTGAACAAGAACTCGAGTTCTTGTTCAATACGAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-753s1c1
Sequence:CCGGCTACCACACCTCTGTTAGCAACTCGAGTTGCTAACAGAGGTGTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-1421s1c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-496s1c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023472.1-1421s21c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1048s21c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-496s21c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-527s21c1
Sequence:CCGGCGATTCGTGAAGTCCTTAAATCTCGAGATTTAAGGACTTCACGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1157s21c1
Sequence:CCGGGAAACAGACTCTGGCTATAATCTCGAGATTATAGCCAGAGTCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023472
VALIDATED
ANKRA2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat, family A (RFXANK-like), 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-517s1c1
Sequence:CCGGCGTGTGTTCTCGATTCGTGAACTCGAGTTCACGAATCGAGAACACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023472.1-1048s1c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-824s1c1
Sequence:CCGGGCTACTCGTATTGAACAAGAACTCGAGTTCTTGTTCAATACGAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023472.1-753s1c1
Sequence:CCGGCTACCACACCTCTGTTAGCAACTCGAGTTGCTAACAGAGGTGTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-1421s1c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023472.1-496s1c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023472.1-1421s21c1
Sequence:CCGGCCTCTGGATAATTCACTTGTTCTCGAGAACAAGTGAATTATCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1048s21c1
Sequence:CCGGCGTCAATGAATATGACTGGAACTCGAGTTCCAGTCATATTCATTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-496s21c1
Sequence:CCGGGCCAAACCGATTTGATATGAACTCGAGTTCATATCAAATCGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-527s21c1
Sequence:CCGGCGATTCGTGAAGTCCTTAAATCTCGAGATTTAAGGACTTCACGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023472.1-1157s21c1
Sequence:CCGGGAAACAGACTCTGGCTATAATCTCGAGATTATAGCCAGAGTCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)