EMAIL THIS PAGE TO A FRIEND

ANKRD10

ankyrin repeat domain 10

114 Gene Product Result for
UniProtKB ID: Q9NXR5, Q5VW12, Q9BV12
Gene ID:
Mouse(102334) ankyrin repeat domain 10
Rat(361183) ankyrin repeat domain 10
domestic guinea pig(100718063) ankyrin repeat domain 10
naked mole-rat(101716323) ankyrin repeat domain 10
sheep(101116585) ankyrin repeat domain 10
chicken(418760) ankyrin repeat domain 10
dog(476986) ankyrin repeat domain 10
cow(510084) ankyrin repeat domain 10
domestic cat(101097039) ankyrin repeat domain 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017664 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017664 Rosetta Predictions human pricing
XM_001075954 Rosetta Predictions rat pricing
XM_341466 Rosetta Predictions rat pricing
NM_133971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047006 predicted 942
2 SASI_Hs01_00047007 predicted 328
3 SASI_Hs01_00047008 predicted 1137
4 SASI_Hs01_00047009 predicted 894
5 SASI_Hs01_00047012 predicted 690
6 SASI_Hs01_00047013 predicted 762
7 SASI_Hs02_00350385 predicted 676
8 SASI_Hs01_00047014 predicted 747
9 SASI_Hs02_00350386 predicted 784
10 SASI_Hs02_00350387 predicted 955
11 SASI_Hs01_00047005 predicted 898
12 SASI_Hs01_00047010 predicted 787
13 SASI_Hs01_00047011 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351619 predicted 824
2 SASI_Rn02_00351620 predicted 1513
3 SASI_Rn02_00351621 predicted 1384
4 SASI_Rn02_00351622 predicted 1435
5 SASI_Rn02_00351623 predicted 1309
6 SASI_Rn02_00351624 predicted 1111
7 SASI_Rn02_00351625 predicted 1089
8 SASI_Rn02_00351626 predicted 1451
9 SASI_Rn02_00351627 predicted 1072
10 SASI_Rn02_00351628 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392962 predicted 822
2 SASI_Rn02_00392963 predicted 1242
3 SASI_Rn02_00392964 predicted 667
4 SASI_Rn02_00392965 predicted 1525
5 SASI_Rn02_00392966 predicted 387
6 SASI_Rn02_00392967 predicted 1046
7 SASI_Rn02_00392968 predicted 1302
8 SASI_Rn02_00392969 predicted 1165
9 SASI_Rn02_00392970 predicted 1111
10 SASI_Rn02_00392971 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122673 predicted 1258
2 SASI_Mm01_00122674 predicted 718
3 SASI_Mm01_00122675 predicted 406
4 SASI_Mm01_00122676 predicted 375
5 SASI_Mm01_00122677 predicted 965
6 SASI_Mm01_00122678 predicted 975
7 SASI_Mm01_00122679 predicted 1107
8 SASI_Mm01_00122680 predicted 978
9 SASI_Mm02_00339086 predicted 866
10 SASI_Mm01_00122682 predicted 264
11 SASI_Mm01_00122681 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017664
VALIDATED
ANKRD10 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 10
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-676s1c1
Sequence:CCGGCAGAATTGTCATCTGAACCATCTCGAGATGGTTCAGATGACAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-941s1c1
Sequence:CCGGCCGTATCGAATACATTGACAACTCGAGTTGTCAATGTATTCGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017664.1-1478s1c1
Sequence:CCGGCGAATGTCACAACTTGTACTTCTCGAGAAGTACAAGTTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017664.1-1444s1c1
Sequence:CCGGCCAGCTCAGAATACCCATGTACTCGAGTACATGGGTATTCTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1190s21c1
Sequence:CCGGGGAGTCCAAGTAGCTGCATAGCTCGAGCTATGCAGCTACTTGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1138s21c1
Sequence:CCGGGAGAAGACCCTGAGAGCTAACCTCGAGGTTAGCTCTCAGGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1643s21c1
Sequence:CCGGCTGATGCCAATCTCAACATTGCTCGAGCAATGTTGAGATTGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1103s21c1
Sequence:CCGGAGGGTTCTCTCTGCATTAGTGCTCGAGCACTAATGCAGAGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-549s21c1
Sequence:CCGGAGAATGCATCAGTGCCCTTGTCTCGAGACAAGGGCACTGATGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-748s21c1
Sequence:CCGGCATATTAGTGTGGGAACAAATCTCGAGATTTGTTCCCACACTAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1564s21c1
Sequence:CCGGGCATGAGTAGGGCTTACTAAGCTCGAGCTTAGTAAGCCCTACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-495s21c1
Sequence:CCGGACCGGATTGTGAGGGTGAAACCTCGAGGTTTCACCCTCACAATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1317s21c1
Sequence:CCGGCGAGCATTCCAAGTCCGTGAACTCGAGTTCACGGACTTGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-813s21c1
Sequence:CCGGAGCTAGAACTGAAGCTCAAAGCTCGAGCTTTGAGCTTCAGTTCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-855s21c1
Sequence:CCGGCACGAATGGCGACACAGAAGACTCGAGTCTTCTGTGTCGCCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017664
VALIDATED
ANKRD10 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 10
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-676s1c1
Sequence:CCGGCAGAATTGTCATCTGAACCATCTCGAGATGGTTCAGATGACAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-941s1c1
Sequence:CCGGCCGTATCGAATACATTGACAACTCGAGTTGTCAATGTATTCGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017664.1-1478s1c1
Sequence:CCGGCGAATGTCACAACTTGTACTTCTCGAGAAGTACAAGTTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017664.1-1444s1c1
Sequence:CCGGCCAGCTCAGAATACCCATGTACTCGAGTACATGGGTATTCTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1190s21c1
Sequence:CCGGGGAGTCCAAGTAGCTGCATAGCTCGAGCTATGCAGCTACTTGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1138s21c1
Sequence:CCGGGAGAAGACCCTGAGAGCTAACCTCGAGGTTAGCTCTCAGGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1643s21c1
Sequence:CCGGCTGATGCCAATCTCAACATTGCTCGAGCAATGTTGAGATTGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1103s21c1
Sequence:CCGGAGGGTTCTCTCTGCATTAGTGCTCGAGCACTAATGCAGAGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-549s21c1
Sequence:CCGGAGAATGCATCAGTGCCCTTGTCTCGAGACAAGGGCACTGATGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-748s21c1
Sequence:CCGGCATATTAGTGTGGGAACAAATCTCGAGATTTGTTCCCACACTAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1564s21c1
Sequence:CCGGGCATGAGTAGGGCTTACTAAGCTCGAGCTTAGTAAGCCCTACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-495s21c1
Sequence:CCGGACCGGATTGTGAGGGTGAAACCTCGAGGTTTCACCCTCACAATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1317s21c1
Sequence:CCGGCGAGCATTCCAAGTCCGTGAACTCGAGTTCACGGACTTGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-813s21c1
Sequence:CCGGAGCTAGAACTGAAGCTCAAAGCTCGAGCTTTGAGCTTCAGTTCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-855s21c1
Sequence:CCGGCACGAATGGCGACACAGAAGACTCGAGTCTTCTGTGTCGCCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017664
VALIDATED
ANKRD10 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 10
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-676s1c1
Sequence:CCGGCAGAATTGTCATCTGAACCATCTCGAGATGGTTCAGATGACAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017664.1-941s1c1
Sequence:CCGGCCGTATCGAATACATTGACAACTCGAGTTGTCAATGTATTCGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017664.1-1478s1c1
Sequence:CCGGCGAATGTCACAACTTGTACTTCTCGAGAAGTACAAGTTGTGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017664.1-1444s1c1
Sequence:CCGGCCAGCTCAGAATACCCATGTACTCGAGTACATGGGTATTCTGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1190s21c1
Sequence:CCGGGGAGTCCAAGTAGCTGCATAGCTCGAGCTATGCAGCTACTTGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1138s21c1
Sequence:CCGGGAGAAGACCCTGAGAGCTAACCTCGAGGTTAGCTCTCAGGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1643s21c1
Sequence:CCGGCTGATGCCAATCTCAACATTGCTCGAGCAATGTTGAGATTGGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1103s21c1
Sequence:CCGGAGGGTTCTCTCTGCATTAGTGCTCGAGCACTAATGCAGAGAGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-549s21c1
Sequence:CCGGAGAATGCATCAGTGCCCTTGTCTCGAGACAAGGGCACTGATGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-748s21c1
Sequence:CCGGCATATTAGTGTGGGAACAAATCTCGAGATTTGTTCCCACACTAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017664.2-1564s21c1
Sequence:CCGGGCATGAGTAGGGCTTACTAAGCTCGAGCTTAGTAAGCCCTACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-495s21c1
Sequence:CCGGACCGGATTGTGAGGGTGAAACCTCGAGGTTTCACCCTCACAATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-1317s21c1
Sequence:CCGGCGAGCATTCCAAGTCCGTGAACTCGAGTTCACGGACTTGGAATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-813s21c1
Sequence:CCGGAGCTAGAACTGAAGCTCAAAGCTCGAGCTTTGAGCTTCAGTTCTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017664.2-855s21c1
Sequence:CCGGCACGAATGGCGACACAGAAGACTCGAGTCTTCTGTGTCGCCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133971
VALIDATED
ANKRD10 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133971.1-2018s1c1
Sequence:CCGGGCTGCATTAAATTCGTGATTTCTCGAGAAATCACGAATTTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133971.1-969s1c1
Sequence:CCGGCCCGTGCTTAACAGGATCTAACTCGAGTTAGATCCTGTTAAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-875s1c1
Sequence:CCGGCCGTGTTGAATACATTGACAACTCGAGTTGTCAATGTATTCAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-713s1c1
Sequence:CCGGGCCTGGAAGACTCAGAATCTTCTCGAGAAGATTCTGAGTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-273s1c1
Sequence:CCGGCGGCAAGTTGGAGTGCTTAATCTCGAGATTAAGCACTCCAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133971
VALIDATED
ANKRD10 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133971.1-2018s1c1
Sequence:CCGGGCTGCATTAAATTCGTGATTTCTCGAGAAATCACGAATTTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133971.1-969s1c1
Sequence:CCGGCCCGTGCTTAACAGGATCTAACTCGAGTTAGATCCTGTTAAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-875s1c1
Sequence:CCGGCCGTGTTGAATACATTGACAACTCGAGTTGTCAATGTATTCAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-713s1c1
Sequence:CCGGGCCTGGAAGACTCAGAATCTTCTCGAGAAGATTCTGAGTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-273s1c1
Sequence:CCGGCGGCAAGTTGGAGTGCTTAATCTCGAGATTAAGCACTCCAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133971
VALIDATED
ANKRD10 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133971.1-2018s1c1
Sequence:CCGGGCTGCATTAAATTCGTGATTTCTCGAGAAATCACGAATTTAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133971.1-969s1c1
Sequence:CCGGCCCGTGCTTAACAGGATCTAACTCGAGTTAGATCCTGTTAAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-875s1c1
Sequence:CCGGCCGTGTTGAATACATTGACAACTCGAGTTGTCAATGTATTCAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-713s1c1
Sequence:CCGGGCCTGGAAGACTCAGAATCTTCTCGAGAAGATTCTGAGTCTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133971.1-273s1c1
Sequence:CCGGCGGCAAGTTGGAGTGCTTAATCTCGAGATTAAGCACTCCAACTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks