EMAIL THIS PAGE TO A FRIEND

ANKRD12

ankyrin repeat domain 12

213 Gene Product Result for
Synonyms: ANCO-2 ANCO1 GAC-1 Nbla00144
UniProtKB ID: Q6UB98, O94951, Q658K1, Q6QMF7, Q9H231, Q9H784
Gene ID:
Human(23253) Summary: This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Mouse(106585) ankyrin repeat domain 12
Rat(316775) ankyrin repeat domain 12
domestic guinea pig(100718743) ankyrin repeat domain 12
naked mole-rat(101710463) ankyrin repeat domain 12
sheep(101106986) ankyrin repeat domain 12
Zebrafish(393119) ankyrin repeat domain 12
dog(480205) ankyrin repeat domain 12
domestic cat(101080329) ankyrin repeat domain 12
cow(534739) ankyrin repeat domain 12
Horse(100049929) ankyrin repeat domain 12
chicken(425900) ankyrin repeat domain 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040705 Anti-ANKRD12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083625 Rosetta Predictions human pricing
NM_015208 Rosetta Predictions human pricing
NM_001108238 Rosetta Predictions rat pricing
NM_001025572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317191 predicted 4717
2 SASI_Hs02_00317192 predicted 4319
3 SASI_Hs02_00317193 predicted 5519
4 SASI_Hs02_00317194 predicted 4167
5 SASI_Hs02_00317195 predicted 4986
6 SASI_Hs02_00317196 predicted 5769
7 SASI_Hs02_00317197 predicted 4388
8 SASI_Hs02_00317198 predicted 4398
9 SASI_Hs02_00317199 predicted 4676
10 SASI_Hs02_00317200 predicted 5005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347314 predicted 4384
2 SASI_Hs02_00347315 predicted 1977
3 SASI_Hs01_00040120 predicted 5585
4 SASI_Hs01_00040121 predicted 4238
5 SASI_Hs01_00040122 predicted 5059
6 SASI_Hs01_00040123 predicted 5834
7 SASI_Hs01_00040124 predicted 4457
8 SASI_Hs01_00040125 predicted 4474
9 SASI_Hs02_00347316 predicted 4744
10 SASI_Hs02_00347317 predicted 5074
11 SASI_Hs01_00040119 predicted 4744
12 SASI_Hs01_00040126 predicted 5759
13 SASI_Hs01_00040127 predicted 3891
14 SASI_Hs01_00040128 predicted 6410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236684 predicted 3963
2 SASI_Rn02_00236685 predicted 704
3 SASI_Rn02_00236686 predicted 6223
4 SASI_Rn02_00236687 predicted 4175
5 SASI_Rn02_00236688 predicted 3993
6 SASI_Rn02_00236689 predicted 3639
7 SASI_Rn02_00236690 predicted 3848
8 SASI_Rn02_00236691 predicted 4824
9 SASI_Rn02_00236692 predicted 6190
10 SASI_Rn02_00236693 predicted 4741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043878 predicted 209
2 SASI_Mm02_00287919 predicted 6115
3 SASI_Mm01_00043879 predicted 3484
4 SASI_Mm01_00043881 predicted 3261
5 SASI_Mm01_00043882 predicted 3966
6 SASI_Mm01_00043883 predicted 3906
7 SASI_Mm01_00043884 predicted 4034
8 SASI_Mm01_00043885 predicted 874
9 SASI_Mm01_00043887 predicted 3487
10 SASI_Mm02_00287920 predicted 4321
11 SASI_Mm01_00043880 predicted 3834
12 SASI_Mm01_00043886 predicted 6147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015208
ANKRD12 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015208.2-7817s1c1
Sequence:CCGGGCTGCTGAACTTGTTAGACATCTCGAGATGTCTAACAAGTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4757s1c1
Sequence:CCGGGCTAATCAAGAGCCAGGTATTCTCGAGAATACCTGGCTCTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8263s1c1
Sequence:CCGGGCACTGGTTCTGTTGAAGTTACTCGAGTAACTTCAACAGAACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8731s1c1
Sequence:CCGGGCCTTCTCATTGGAAATGTATCTCGAGATACATTTCCAATGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-6032s1c1
Sequence:CCGGGCAAGAACATTGGCAAATCAACTCGAGTTGATTTGCCAATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4350s1c1
Sequence:CCGGGCAAGTATGTTTCAGCTGATACTCGAGTATCAGCTGAAACATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4245s21c1
Sequence:CCGGAGCAATCAAGGTAGCTTATTACTCGAGTAATAAGCTACCTTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2136s21c1
Sequence:CCGGGAAGATCATAGTCCAACATTTCTCGAGAAATGTTGGACTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4059s21c1
Sequence:CCGGGACTTGCCGGAGCGGATTAAACTCGAGTTTAATCCGCTCCGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2628s21c1
Sequence:CCGGAGTGCCATTGAGGAATCTATACTCGAGTATAGATTCCTCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015208
ANKRD12 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015208.2-7817s1c1
Sequence:CCGGGCTGCTGAACTTGTTAGACATCTCGAGATGTCTAACAAGTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4757s1c1
Sequence:CCGGGCTAATCAAGAGCCAGGTATTCTCGAGAATACCTGGCTCTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8263s1c1
Sequence:CCGGGCACTGGTTCTGTTGAAGTTACTCGAGTAACTTCAACAGAACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8731s1c1
Sequence:CCGGGCCTTCTCATTGGAAATGTATCTCGAGATACATTTCCAATGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-6032s1c1
Sequence:CCGGGCAAGAACATTGGCAAATCAACTCGAGTTGATTTGCCAATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4350s1c1
Sequence:CCGGGCAAGTATGTTTCAGCTGATACTCGAGTATCAGCTGAAACATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4245s21c1
Sequence:CCGGAGCAATCAAGGTAGCTTATTACTCGAGTAATAAGCTACCTTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2136s21c1
Sequence:CCGGGAAGATCATAGTCCAACATTTCTCGAGAAATGTTGGACTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4059s21c1
Sequence:CCGGGACTTGCCGGAGCGGATTAAACTCGAGTTTAATCCGCTCCGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2628s21c1
Sequence:CCGGAGTGCCATTGAGGAATCTATACTCGAGTATAGATTCCTCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015208
ANKRD12 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015208.2-7817s1c1
Sequence:CCGGGCTGCTGAACTTGTTAGACATCTCGAGATGTCTAACAAGTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4757s1c1
Sequence:CCGGGCTAATCAAGAGCCAGGTATTCTCGAGAATACCTGGCTCTTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8263s1c1
Sequence:CCGGGCACTGGTTCTGTTGAAGTTACTCGAGTAACTTCAACAGAACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015208.2-8731s1c1
Sequence:CCGGGCCTTCTCATTGGAAATGTATCTCGAGATACATTTCCAATGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-6032s1c1
Sequence:CCGGGCAAGAACATTGGCAAATCAACTCGAGTTGATTTGCCAATGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015208.2-4350s1c1
Sequence:CCGGGCAAGTATGTTTCAGCTGATACTCGAGTATCAGCTGAAACATACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4245s21c1
Sequence:CCGGAGCAATCAAGGTAGCTTATTACTCGAGTAATAAGCTACCTTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2136s21c1
Sequence:CCGGGAAGATCATAGTCCAACATTTCTCGAGAAATGTTGGACTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-4059s21c1
Sequence:CCGGGACTTGCCGGAGCGGATTAAACTCGAGTTTAATCCGCTCCGGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015208.3-2628s21c1
Sequence:CCGGAGTGCCATTGAGGAATCTATACTCGAGTATAGATTCCTCAATGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025572
ANKRD12 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7265s1c1
Sequence:CCGGCCCAAACAACAACAACAACAACTCGAGTTGTTGTTGTTGTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-6249s1c1
Sequence:CCGGCCACGTATAAGTCTCTCAGTACTCGAGTACTGAGAGACTTATACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-3867s1c1
Sequence:CCGGGCTCGGAATCTCAGTTGTCATCTCGAGATGACAACTGAGATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5744s21c1
Sequence:CCGGGATGAATACGTAACGTTTAATCTCGAGATTAAACGTTACGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7697s1c1
Sequence:CCGGGATCTGACATAGATTAGATATCTCGAGATATCTAATCTATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5830s21c1
Sequence:CCGGTTCGCTGTCAGATCCACTTAACTCGAGTTAAGTGGATCTGACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025572.1-8033s21c1
Sequence:CCGGTGTACTGGCATGCGCAATAAACTCGAGTTTATTGCGCATGCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-3959s21c1
Sequence:CCGGGAACTACCAGACCGACTTAAACTCGAGTTTAAGTCGGTCTGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-1927s21c1
Sequence:CCGGTGATCTCACTCGGTATGATAACTCGAGTTATCATACCGAGTGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025572
ANKRD12 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7265s1c1
Sequence:CCGGCCCAAACAACAACAACAACAACTCGAGTTGTTGTTGTTGTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-6249s1c1
Sequence:CCGGCCACGTATAAGTCTCTCAGTACTCGAGTACTGAGAGACTTATACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-3867s1c1
Sequence:CCGGGCTCGGAATCTCAGTTGTCATCTCGAGATGACAACTGAGATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5744s21c1
Sequence:CCGGGATGAATACGTAACGTTTAATCTCGAGATTAAACGTTACGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7697s1c1
Sequence:CCGGGATCTGACATAGATTAGATATCTCGAGATATCTAATCTATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5830s21c1
Sequence:CCGGTTCGCTGTCAGATCCACTTAACTCGAGTTAAGTGGATCTGACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025572.1-8033s21c1
Sequence:CCGGTGTACTGGCATGCGCAATAAACTCGAGTTTATTGCGCATGCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-3959s21c1
Sequence:CCGGGAACTACCAGACCGACTTAAACTCGAGTTTAAGTCGGTCTGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-1927s21c1
Sequence:CCGGTGATCTCACTCGGTATGATAACTCGAGTTATCATACCGAGTGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025572
ANKRD12 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192162    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7265s1c1
Sequence:CCGGCCCAAACAACAACAACAACAACTCGAGTTGTTGTTGTTGTTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-6249s1c1
Sequence:CCGGCCACGTATAAGTCTCTCAGTACTCGAGTACTGAGAGACTTATACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025572.1-3867s1c1
Sequence:CCGGGCTCGGAATCTCAGTTGTCATCTCGAGATGACAACTGAGATTCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5744s21c1
Sequence:CCGGGATGAATACGTAACGTTTAATCTCGAGATTAAACGTTACGTATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216337    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025572.1-7697s1c1
Sequence:CCGGGATCTGACATAGATTAGATATCTCGAGATATCTAATCTATGTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-5830s21c1
Sequence:CCGGTTCGCTGTCAGATCCACTTAACTCGAGTTAAGTGGATCTGACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025572.1-8033s21c1
Sequence:CCGGTGTACTGGCATGCGCAATAAACTCGAGTTTATTGCGCATGCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-3959s21c1
Sequence:CCGGGAACTACCAGACCGACTTAAACTCGAGTTTAAGTCGGTCTGGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025572.1-1927s21c1
Sequence:CCGGTGATCTCACTCGGTATGATAACTCGAGTTATCATACCGAGTGAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks