EMAIL THIS PAGE TO A FRIEND

ANKRD13A

ankyrin repeat domain 13A

216 Gene Product Result for
Synonyms: ANKRD13 NY-REN-25
UniProtKB ID: Q8IZ07, O60736
Gene ID:
Mouse(68420) ankyrin repeat domain 13a
Rat(360823) ankyrin repeat domain 13a
Zebrafish(556837) ankyrin repeat domain 13A
cow(511883) ankyrin repeat domain 13A
Horse(100066442) ankyrin repeat domain 13A
domestic cat(101084139) ankyrin repeat domain 13A
dog(609384) ankyrin repeat domain 13A
chicken(416902) ankyrin repeat domain 13A
sheep(101121549) ankyrin repeat domain 13A
Domestic Rabbit(100349196) ankyrin repeat domain 13A
naked mole-rat(101701933) ankyrin repeat domain 13A
domestic guinea pig(100728280) ankyrin repeat domain 13A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033121 Rosetta Predictions human pricing
NM_001012148 Rosetta Predictions rat pricing
XM_573411 Rosetta Predictions rat pricing
NM_026718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170233 predicted 1252
2 SASI_Hs01_00170234 predicted 1505
3 SASI_Hs01_00170235 predicted 920
4 SASI_Hs01_00170236 predicted 1094
5 SASI_Hs01_00170237 predicted 1998
6 SASI_Hs01_00170238 predicted 1806
7 SASI_Hs01_00170239 predicted 1633
8 SASI_Hs01_00170240 predicted 1617
9 SASI_Hs01_00170241 predicted 1307
10 SASI_Hs02_00360847 predicted 1023
11 SASI_Hs01_00170242 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046498 predicted 485
2 SASI_Rn01_00046499 predicted 937
3 SASI_Rn01_00046500 predicted 1369
4 SASI_Rn01_00046501 predicted 478
5 SASI_Rn01_00046502 predicted 1376
6 SASI_Rn01_00046504 predicted 879
7 SASI_Rn01_00046505 predicted 1569
8 SASI_Rn01_00046506 predicted 1292
9 SASI_Rn01_00046507 predicted 908
10 SASI_Rn02_00200326 predicted 1857
11 SASI_Rn01_00046503 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163140 predicted 857
2 SASI_Rn01_00163141 predicted 1304
3 SASI_Rn01_00163142 predicted 1465
4 SASI_Rn01_00163143 predicted 844
5 SASI_Rn01_00163144 predicted 1147
6 SASI_Rn01_00163145 predicted 1247
7 SASI_Rn01_00163146 predicted 1004
8 SASI_Rn01_00163147 predicted 2141
9 SASI_Rn01_00163148 predicted 1274
10 SASI_Rn01_00163149 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107973 predicted 914
2 SASI_Mm01_00107974 predicted 253
3 SASI_Mm01_00107975 predicted 874
4 SASI_Mm01_00107976 predicted 1638
5 SASI_Mm01_00107977 predicted 1088
6 SASI_Mm01_00107978 predicted 207
7 SASI_Mm01_00107979 predicted 1333
8 SASI_Mm01_00107980 predicted 1265
9 SASI_Mm01_00107981 predicted 508
10 SASI_Mm02_00330754 predicted 308
11 SASI_Mm01_00107972 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033121
VALIDATED
ANKRD13A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033121.1-2267s21c1
Sequence:CCGGGAGCATCATCACTTTCCATTACTCGAGTAATGGAAAGTGATGATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033121.1-1393s21c1
Sequence:CCGGCATTCCCATCATTGACCTAATCTCGAGATTAGGTCAATGATGGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1559s1c1
Sequence:CCGGGCCGAAGAATCTGTATCTCAACTCGAGTTGAGATACAGATTCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-731s1c1
Sequence:CCGGGATATCACATTGCTGGGATTTCTCGAGAAATCCCAGCAATGTGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1520s1c1
Sequence:CCGGGCACGGATTACATTTGGAAATCTCGAGATTTCCAAATGTAATCCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-431s1c1
Sequence:CCGGCGAGTCTTACTCCGACATAAACTCGAGTTTATGTCGGAGTAAGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1315s1c1
Sequence:CCGGGCTGACGATTAGAACACAGAACTCGAGTTCTGTGTTCTAATCGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033121
VALIDATED
ANKRD13A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033121.1-2267s21c1
Sequence:CCGGGAGCATCATCACTTTCCATTACTCGAGTAATGGAAAGTGATGATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033121.1-1393s21c1
Sequence:CCGGCATTCCCATCATTGACCTAATCTCGAGATTAGGTCAATGATGGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1559s1c1
Sequence:CCGGGCCGAAGAATCTGTATCTCAACTCGAGTTGAGATACAGATTCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-731s1c1
Sequence:CCGGGATATCACATTGCTGGGATTTCTCGAGAAATCCCAGCAATGTGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1520s1c1
Sequence:CCGGGCACGGATTACATTTGGAAATCTCGAGATTTCCAAATGTAATCCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-431s1c1
Sequence:CCGGCGAGTCTTACTCCGACATAAACTCGAGTTTATGTCGGAGTAAGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1315s1c1
Sequence:CCGGGCTGACGATTAGAACACAGAACTCGAGTTCTGTGTTCTAATCGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033121
VALIDATED
ANKRD13A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033121.1-2267s21c1
Sequence:CCGGGAGCATCATCACTTTCCATTACTCGAGTAATGGAAAGTGATGATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033121.1-1393s21c1
Sequence:CCGGCATTCCCATCATTGACCTAATCTCGAGATTAGGTCAATGATGGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1559s1c1
Sequence:CCGGGCCGAAGAATCTGTATCTCAACTCGAGTTGAGATACAGATTCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-731s1c1
Sequence:CCGGGATATCACATTGCTGGGATTTCTCGAGAAATCCCAGCAATGTGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1520s1c1
Sequence:CCGGGCACGGATTACATTTGGAAATCTCGAGATTTCCAAATGTAATCCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-431s1c1
Sequence:CCGGCGAGTCTTACTCCGACATAAACTCGAGTTTATGTCGGAGTAAGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_033121.1-1315s1c1
Sequence:CCGGGCTGACGATTAGAACACAGAACTCGAGTTCTGTGTTCTAATCGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026718
VALIDATED
ANKRD13A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-2549s21c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-901s21c1
Sequence:CCGGTAAACAACGTGAGCGTGATAACTCGAGTTATCACGCTCACGTTGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1835s21c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-687s21c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1351s21c1
Sequence:CCGGCACGGATCACATTCGGAAATGCTCGAGCATTTCCGAATGTGATCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-514s1c1
Sequence:CCGGCCAACGATGTCTGTCGCATATCTCGAGATATGCGACAGACATCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026718.2-1835s1c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-2549s1c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-687s1c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026718
VALIDATED
ANKRD13A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-2549s21c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-901s21c1
Sequence:CCGGTAAACAACGTGAGCGTGATAACTCGAGTTATCACGCTCACGTTGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1835s21c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-687s21c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1351s21c1
Sequence:CCGGCACGGATCACATTCGGAAATGCTCGAGCATTTCCGAATGTGATCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-514s1c1
Sequence:CCGGCCAACGATGTCTGTCGCATATCTCGAGATATGCGACAGACATCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026718.2-1835s1c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-2549s1c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-687s1c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026718
VALIDATED
ANKRD13A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-2549s21c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-901s21c1
Sequence:CCGGTAAACAACGTGAGCGTGATAACTCGAGTTATCACGCTCACGTTGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1835s21c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-687s21c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026718.2-1351s21c1
Sequence:CCGGCACGGATCACATTCGGAAATGCTCGAGCATTTCCGAATGTGATCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-514s1c1
Sequence:CCGGCCAACGATGTCTGTCGCATATCTCGAGATATGCGACAGACATCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026718.2-1835s1c1
Sequence:CCGGGCTGTCTCTCACTGAGAAATACTCGAGTATTTCTCAGTGAGAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182611    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-2549s1c1
Sequence:CCGGGCTACACCAAAGGCAGCTAATCTCGAGATTAGCTGCCTTTGGTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026718.2-687s1c1
Sequence:CCGGGAACACTTCGATCTTTCCCAACTCGAGTTGGGAAAGATCGAAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)