EMAIL THIS PAGE TO A FRIEND

ANKRD13B

ankyrin repeat domain 13B

160 Gene Product Result for
UniProtKB ID: Q86YJ7, Q8N7S9
Gene ID:
Mouse(268445) ankyrin repeat domain 13b
Rat(360575) ankyrin repeat domain 13B
domestic guinea pig(100723176) ankyrin repeat domain 13B
naked mole-rat(101701050) ankyrin repeat domain 13B
sheep(101110425) ankyrin repeat domain 13B
Domestic Rabbit(100347268) ankyrin repeat domain 13B
Zebrafish(568981) ankyrin repeat domain 13B
cow(616514) ankyrin repeat domain 13B
domestic cat(101083306) ankyrin repeat domain 13B
dog(491181) ankyrin repeat domain 13B
chicken(100859164) ankyrin repeat domain 13B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152345 Rosetta Predictions human pricing
XM_001080794 Rosetta Predictions rat pricing
XM_340854 Rosetta Predictions rat pricing
NM_172945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137192 predicted 825
2 SASI_Hs01_00137193 predicted 1083
3 SASI_Hs02_00365964 predicted 2352
4 SASI_Hs01_00137196 predicted 936
5 SASI_Hs02_00365965 predicted 2337
6 SASI_Hs01_00137197 predicted 1081
7 SASI_Hs01_00137198 predicted 636
8 SASI_Hs02_00365966 predicted 2303
9 SASI_Hs01_00137199 predicted 907
10 SASI_Hs01_00137200 predicted 914
11 SASI_Hs01_00137191 predicted 1059
12 SASI_Hs01_00137194 predicted 954
13 SASI_Hs01_00137195 predicted 2403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369392 predicted 957
2 SASI_Rn02_00369393 predicted 1014
3 SASI_Rn02_00369394 predicted 325
4 SASI_Rn02_00369395 predicted 904
5 SASI_Rn02_00369396 predicted 2133
6 SASI_Rn02_00369397 predicted 507
7 SASI_Rn02_00369398 predicted 2178
8 SASI_Rn02_00369399 predicted 2189
9 SASI_Rn02_00369400 predicted 1363
10 SASI_Rn02_00369401 predicted 1896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392020 predicted 1080
2 SASI_Rn02_00392021 predicted 1130
3 SASI_Rn02_00392022 predicted 451
4 SASI_Rn02_00392023 predicted 1029
5 SASI_Rn02_00392024 predicted 2261
6 SASI_Rn02_00392025 predicted 635
7 SASI_Rn02_00392026 predicted 2306
8 SASI_Rn02_00392027 predicted 2316
9 SASI_Rn02_00392028 predicted 1489
10 SASI_Rn02_00392029 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344972 predicted 972
2 SASI_Mm02_00344973 predicted 854
3 SASI_Mm02_00344974 predicted 919
4 SASI_Mm02_00344975 predicted 987
5 SASI_Mm01_00185792 predicted 2404
6 SASI_Mm02_00344976 predicted 532
7 SASI_Mm02_00344977 predicted 561
8 SASI_Mm02_00344978 predicted 817
9 SASI_Mm01_00185796 predicted 2367
10 SASI_Mm02_00344979 predicted 484
11 SASI_Mm01_00185793 predicted 719
12 SASI_Mm01_00185794 predicted 706
13 SASI_Mm01_00185795 predicted 1028
14 SASI_Mm01_00185797 predicted 707
15 SASI_Mm01_00185798 predicted 1720
16 SASI_Mm01_00185799 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152345
ANKRD13B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1060s1c1
Sequence:CCGGCAAAGGCTGTAAGACACCTTTCTCGAGAAAGGTGTCTTACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152345.3-2349s1c1
Sequence:CCGGCTAGCCTCTGTGGTTGTACATCTCGAGATGTACAACCACAGAGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1053s1c1
Sequence:CCGGGCAAGGTCAAAGGCTGTAAGACTCGAGTCTTACAGCCTTTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1243s1c1
Sequence:CCGGGACCACCAAGACACAGAAGTTCTCGAGAACTTCTGTGTCTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1017s1c1
Sequence:CCGGGCACACGGACAGAACATCTTTCTCGAGAAAGATGTTCTGTCCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1022s1c1
Sequence:CCGGCGGACAGAACATCTTTCAGAACTCGAGTTCTGAAAGATGTTCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-898s1c1
Sequence:CCGGGAATATCTCCTTTGAGAGGAACTCGAGTTCCTCTCAAAGGAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1401s1c1
Sequence:CCGGGCTTCCCAGTTAAGATTGAAACTCGAGTTTCAATCTTAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-1376s21c1
Sequence:CCGGCCCGATCTTCCACATCCTCAACTCGAGTTGAGGATGTGGAAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-922s21c1
Sequence:CCGGGGTATGAAGCTAAGGTGTATGCTCGAGCATACACCTTAGCTTCATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152345
ANKRD13B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1060s1c1
Sequence:CCGGCAAAGGCTGTAAGACACCTTTCTCGAGAAAGGTGTCTTACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152345.3-2349s1c1
Sequence:CCGGCTAGCCTCTGTGGTTGTACATCTCGAGATGTACAACCACAGAGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1053s1c1
Sequence:CCGGGCAAGGTCAAAGGCTGTAAGACTCGAGTCTTACAGCCTTTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1243s1c1
Sequence:CCGGGACCACCAAGACACAGAAGTTCTCGAGAACTTCTGTGTCTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1017s1c1
Sequence:CCGGGCACACGGACAGAACATCTTTCTCGAGAAAGATGTTCTGTCCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1022s1c1
Sequence:CCGGCGGACAGAACATCTTTCAGAACTCGAGTTCTGAAAGATGTTCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-898s1c1
Sequence:CCGGGAATATCTCCTTTGAGAGGAACTCGAGTTCCTCTCAAAGGAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1401s1c1
Sequence:CCGGGCTTCCCAGTTAAGATTGAAACTCGAGTTTCAATCTTAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-1376s21c1
Sequence:CCGGCCCGATCTTCCACATCCTCAACTCGAGTTGAGGATGTGGAAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-922s21c1
Sequence:CCGGGGTATGAAGCTAAGGTGTATGCTCGAGCATACACCTTAGCTTCATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152345
ANKRD13B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1060s1c1
Sequence:CCGGCAAAGGCTGTAAGACACCTTTCTCGAGAAAGGTGTCTTACAGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139696    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152345.3-2349s1c1
Sequence:CCGGCTAGCCTCTGTGGTTGTACATCTCGAGATGTACAACCACAGAGGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1053s1c1
Sequence:CCGGGCAAGGTCAAAGGCTGTAAGACTCGAGTCTTACAGCCTTTGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152345.3-1243s1c1
Sequence:CCGGGACCACCAAGACACAGAAGTTCTCGAGAACTTCTGTGTCTTGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1017s1c1
Sequence:CCGGGCACACGGACAGAACATCTTTCTCGAGAAAGATGTTCTGTCCGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1022s1c1
Sequence:CCGGCGGACAGAACATCTTTCAGAACTCGAGTTCTGAAAGATGTTCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-898s1c1
Sequence:CCGGGAATATCTCCTTTGAGAGGAACTCGAGTTCCTCTCAAAGGAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152345.3-1401s1c1
Sequence:CCGGGCTTCCCAGTTAAGATTGAAACTCGAGTTTCAATCTTAACTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-1376s21c1
Sequence:CCGGCCCGATCTTCCACATCCTCAACTCGAGTTGAGGATGTGGAAGATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152345.4-922s21c1
Sequence:CCGGGGTATGAAGCTAAGGTGTATGCTCGAGCATACACCTTAGCTTCATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172945
VALIDATED
ANKRD13B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172945.2-565s21c1
Sequence:CCGGATTTGCCCTAGTGACACATACCTCGAGGTATGTGTCACTAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1809s21c1
Sequence:CCGGTGGTATCGAGAACCCGTTATCCTCGAGGATAACGGGTTCTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1018s21c1
Sequence:CCGGGGCAAAGTCAAAGGTTGTAAGCTCGAGCTTACAACCTTTGACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1376s21c1
Sequence:CCGGTCAAGATTGAAATCCCGATTTCTCGAGAAATCGGGATTTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-3067s21c1
Sequence:CCGGGGCCGACTAACACCCTTTATCCTCGAGGATAAAGGGTGTTAGTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172945
VALIDATED
ANKRD13B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172945.2-565s21c1
Sequence:CCGGATTTGCCCTAGTGACACATACCTCGAGGTATGTGTCACTAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1809s21c1
Sequence:CCGGTGGTATCGAGAACCCGTTATCCTCGAGGATAACGGGTTCTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1018s21c1
Sequence:CCGGGGCAAAGTCAAAGGTTGTAAGCTCGAGCTTACAACCTTTGACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1376s21c1
Sequence:CCGGTCAAGATTGAAATCCCGATTTCTCGAGAAATCGGGATTTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-3067s21c1
Sequence:CCGGGGCCGACTAACACCCTTTATCCTCGAGGATAAAGGGTGTTAGTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172945
VALIDATED
ANKRD13B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172945.2-565s21c1
Sequence:CCGGATTTGCCCTAGTGACACATACCTCGAGGTATGTGTCACTAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1809s21c1
Sequence:CCGGTGGTATCGAGAACCCGTTATCCTCGAGGATAACGGGTTCTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1018s21c1
Sequence:CCGGGGCAAAGTCAAAGGTTGTAAGCTCGAGCTTACAACCTTTGACTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-1376s21c1
Sequence:CCGGTCAAGATTGAAATCCCGATTTCTCGAGAAATCGGGATTTCAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172945.2-3067s21c1
Sequence:CCGGGGCCGACTAACACCCTTTATCCTCGAGGATAAAGGGTGTTAGTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks