EMAIL THIS PAGE TO A FRIEND

ANKRD13C

ankyrin repeat domain 13C

129 Gene Product Result for
Synonyms: RP4-677H15.5 dJ677H15.3
UniProtKB ID: Q8N6S4, B3KQ97, Q5VYH4, Q5VYH5, Q6PJE4, Q9H0N9
Gene ID:
Mouse(433667) ankyrin repeat domain 13c
Rat(685374) ankyrin repeat domain 13C
Zebrafish(325167) ankyrin repeat domain 13C
dog(490215) ankyrin repeat domain 13C
domestic cat(101087764) ankyrin repeat domain 13C
Horse(100053662) ankyrin repeat domain 13C
cow(528021) ankyrin repeat domain 13C
chicken(424715) ankyrin repeat domain 13C
sheep(101118233) ankyrin repeat domain 13C
Domestic Rabbit(100351017) ankyrin repeat domain 13C
naked mole-rat(101719322) ankyrin repeat domain 13C
domestic guinea pig(100717885) ankyrin repeat domain 13C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030816 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160311 MISSION® esiRNA esiRNA targeting mouse Ankrd13c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030816 Rosetta Predictions human pricing
XM_001062165 Rosetta Predictions rat pricing
NM_001013806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096344 predicted 1459
2 SASI_Hs01_00096345 predicted 1744
3 SASI_Hs01_00096346 predicted 974
4 SASI_Hs01_00096347 predicted 1708
5 SASI_Hs01_00096348 predicted 1255
6 SASI_Hs01_00096349 predicted 1476
7 SASI_Hs01_00096350 predicted 1107
8 SASI_Hs02_00358395 predicted 1863
9 SASI_Hs01_00096351 predicted 1458
10 SASI_Hs01_00096352 predicted 1694
11 SASI_Hs01_00096353 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302571 predicted 843
2 SASI_Rn02_00302572 predicted 1769
3 SASI_Rn02_00302573 predicted 876
4 SASI_Rn02_00302574 predicted 1425
5 SASI_Rn02_00302575 predicted 1531
6 SASI_Rn02_00302576 predicted 1447
7 SASI_Rn02_00302577 predicted 1543
8 SASI_Rn02_00302578 predicted 960
9 SASI_Rn02_00302579 predicted 867
10 SASI_Rn02_00302580 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131899 predicted 1749
2 SASI_Mm01_00131900 predicted 1453
3 SASI_Mm01_00131901 predicted 1736
4 SASI_Mm01_00131902 predicted 844
5 SASI_Mm02_00287371 predicted 839
6 SASI_Mm01_00131903 predicted 1019
7 SASI_Mm01_00131904 predicted 824
8 SASI_Mm01_00131905 predicted 1501
9 SASI_Mm02_00287372 predicted 1039
10 SASI_Mm01_00131906 predicted 1495
11 SASI_Mm01_00131907 predicted 1155
12 SASI_Mm01_00131908 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013806
VALIDATED
ANKRD13C MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13C
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1328s21c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-539s21c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013806.1-2262s1c1
Sequence:CCGGCCTTGATAACAGTTGCATTTACTCGAGTAAATGCAACTGTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1441s21c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013806.1-1869s21c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-739s1c1
Sequence:CCGGCCTAGAACTTCACTGGGATTTCTCGAGAAATCCCAGTGAAGTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-539s1c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-853s1c1
Sequence:CCGGCATAGACTTTACTGACATGAACTCGAGTTCATGTCAGTAAAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1026s1c1
Sequence:CCGGGCAGTGATATTTATTCTGCAACTCGAGTTGCAGAATAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013806.1-1328s1c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1869s1c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1441s1c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-1608s1c1
Sequence:CCGGGATGTGATGAATTTGATGGATCTCGAGATCCATCAAATTCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013806
VALIDATED
ANKRD13C MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13C
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1328s21c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-539s21c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013806.1-2262s1c1
Sequence:CCGGCCTTGATAACAGTTGCATTTACTCGAGTAAATGCAACTGTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1441s21c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013806.1-1869s21c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-739s1c1
Sequence:CCGGCCTAGAACTTCACTGGGATTTCTCGAGAAATCCCAGTGAAGTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-539s1c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-853s1c1
Sequence:CCGGCATAGACTTTACTGACATGAACTCGAGTTCATGTCAGTAAAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1026s1c1
Sequence:CCGGGCAGTGATATTTATTCTGCAACTCGAGTTGCAGAATAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013806.1-1328s1c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1869s1c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1441s1c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-1608s1c1
Sequence:CCGGGATGTGATGAATTTGATGGATCTCGAGATCCATCAAATTCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013806
VALIDATED
ANKRD13C MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13C
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1328s21c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-539s21c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013806.1-2262s1c1
Sequence:CCGGCCTTGATAACAGTTGCATTTACTCGAGTAAATGCAACTGTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013806.1-1441s21c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013806.1-1869s21c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-739s1c1
Sequence:CCGGCCTAGAACTTCACTGGGATTTCTCGAGAAATCCCAGTGAAGTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-539s1c1
Sequence:CCGGGCACATTTACTGTTGGCTCATCTCGAGATGAGCCAACAGTAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-853s1c1
Sequence:CCGGCATAGACTTTACTGACATGAACTCGAGTTCATGTCAGTAAAGTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1026s1c1
Sequence:CCGGGCAGTGATATTTATTCTGCAACTCGAGTTGCAGAATAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013806.1-1328s1c1
Sequence:CCGGGAAGAATACATATCCGCTGAACTCGAGTTCAGCGGATATGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1869s1c1
Sequence:CCGGCCTGAGACCTTCCTATGTAAACTCGAGTTTACATAGGAAGGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013806.1-1441s1c1
Sequence:CCGGCCTGGGAATTGAGTCATTGTTCTCGAGAACAATGACTCAATTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013806.1-1608s1c1
Sequence:CCGGGATGTGATGAATTTGATGGATCTCGAGATCCATCAAATTCATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030816
VALIDATED
ANKRD13C MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1187s1c1
Sequence:CCGGGCAGTGATATTTACTCTGCAACTCGAGTTGCAGAGTAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-2528s1c1
Sequence:CCGGGCAATTCATTGTGGTGCTATTCTCGAGAATAGCACCACAATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1783s1c1
Sequence:CCGGGATGGCTCCATCTTTACTATACTCGAGTATAGTAAAGATGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030816.1-3153s1c1
Sequence:CCGGCCTGATGAATGTCTCAAGAATCTCGAGATTCTTGAGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1653s1c1
Sequence:CCGGGCACTTTAACAAGCTTAGAGACTCGAGTCTCTAAGCTTGTTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030816.1-1665s1c1
Sequence:CCGGGCTTAGAGAATTTGTTCAGATCTCGAGATCTGAACAAATTCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1308s1c1
Sequence:CCGGCCTGGTGAATGGACTTGTTATCTCGAGATAACAAGTCCATTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1759s1c1
Sequence:CCGGCAGGAGTTTCGATACGATGAACTCGAGTTCATCGTATCGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1438s1c1
Sequence:CCGGCCGATTCGAAGACAGTCTCTTCTCGAGAAGAGACTGTCTTCGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1590s1c1
Sequence:CCGGCCAGGAATTTCCCTTAGGGATCTCGAGATCCCTAAGGGAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030816
VALIDATED
ANKRD13C MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1187s1c1
Sequence:CCGGGCAGTGATATTTACTCTGCAACTCGAGTTGCAGAGTAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-2528s1c1
Sequence:CCGGGCAATTCATTGTGGTGCTATTCTCGAGAATAGCACCACAATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1783s1c1
Sequence:CCGGGATGGCTCCATCTTTACTATACTCGAGTATAGTAAAGATGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030816.1-3153s1c1
Sequence:CCGGCCTGATGAATGTCTCAAGAATCTCGAGATTCTTGAGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1653s1c1
Sequence:CCGGGCACTTTAACAAGCTTAGAGACTCGAGTCTCTAAGCTTGTTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030816.1-1665s1c1
Sequence:CCGGGCTTAGAGAATTTGTTCAGATCTCGAGATCTGAACAAATTCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1308s1c1
Sequence:CCGGCCTGGTGAATGGACTTGTTATCTCGAGATAACAAGTCCATTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1759s1c1
Sequence:CCGGCAGGAGTTTCGATACGATGAACTCGAGTTCATCGTATCGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1438s1c1
Sequence:CCGGCCGATTCGAAGACAGTCTCTTCTCGAGAAGAGACTGTCTTCGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1590s1c1
Sequence:CCGGCCAGGAATTTCCCTTAGGGATCTCGAGATCCCTAAGGGAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030816
VALIDATED
ANKRD13C MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1187s1c1
Sequence:CCGGGCAGTGATATTTACTCTGCAACTCGAGTTGCAGAGTAAATATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-2528s1c1
Sequence:CCGGGCAATTCATTGTGGTGCTATTCTCGAGAATAGCACCACAATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1783s1c1
Sequence:CCGGGATGGCTCCATCTTTACTATACTCGAGTATAGTAAAGATGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030816.1-3153s1c1
Sequence:CCGGCCTGATGAATGTCTCAAGAATCTCGAGATTCTTGAGACATTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1653s1c1
Sequence:CCGGGCACTTTAACAAGCTTAGAGACTCGAGTCTCTAAGCTTGTTAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030816.1-1665s1c1
Sequence:CCGGGCTTAGAGAATTTGTTCAGATCTCGAGATCTGAACAAATTCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1308s1c1
Sequence:CCGGCCTGGTGAATGGACTTGTTATCTCGAGATAACAAGTCCATTCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1759s1c1
Sequence:CCGGCAGGAGTTTCGATACGATGAACTCGAGTTCATCGTATCGAAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030816.1-1438s1c1
Sequence:CCGGCCGATTCGAAGACAGTCTCTTCTCGAGAAGAGACTGTCTTCGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_030816.1-1590s1c1
Sequence:CCGGCCAGGAATTTCCCTTAGGGATCTCGAGATCCCTAAGGGAAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks