EMAIL THIS PAGE TO A FRIEND

ANKRD13D

ankyrin repeat domain 13 family, member D

52 Gene Product Result for
UniProtKB ID: Q6ZTN6, D6RCN6, Q0VAK0, Q0VGC3, Q6ZVD0, Q86SU1
Gene ID:
Mouse(68423) ankyrin repeat domain 13 family, member D
Rat(361699) ankyrin repeat domain 13 family, member D
domestic guinea pig(100720609) ankyrin repeat domain 13 family, member D
naked mole-rat(101707848) ankyrin repeat domain 13 family, member D
sheep(101108527) ankyrin repeat domain 13 family, member D
cow(505682) ankyrin repeat domain 13 family, member D
Horse(100059036) ankyrin repeat domain 13 family, member D
domestic cat(101090800) ankyrin repeat domain 13 family, member D
dog(483700) ankyrin repeat domain 13 family, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207354 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077991 MISSION® esiRNA esiRNA targeting mouse Ankrd13d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207354 Rosetta Predictions human pricing
NM_001108514 Rosetta Predictions rat pricing
NM_026720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125624 predicted 957
2 SASI_Hs01_00125625 predicted 1385
3 SASI_Hs01_00125626 predicted 1025
4 SASI_Hs01_00125627 predicted 1524
5 SASI_Hs01_00125628 predicted 1314
6 SASI_Hs02_00373911 predicted 1330
7 SASI_Hs02_00373912 predicted 604
8 SASI_Hs01_00125629 predicted 948
9 SASI_Hs01_00125630 predicted 717
10 SASI_Hs01_00125632 predicted 958
11 SASI_Hs01_00125631 predicted 1072
12 SASI_Hs01_00125633 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239399 predicted 511
2 SASI_Rn02_00239400 predicted 992
3 SASI_Rn02_00239401 predicted 1106
4 SASI_Rn02_00239402 predicted 1207
5 SASI_Rn02_00239403 predicted 815
6 SASI_Rn02_00239404 predicted 295
7 SASI_Rn02_00239405 predicted 902
8 SASI_Rn02_00239406 predicted 866
9 SASI_Rn02_00239407 predicted 907
10 SASI_Rn02_00239408 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026276 predicted 528
2 SASI_Mm02_00330756 predicted 521
3 SASI_Mm02_00330757 predicted 1141
4 SASI_Mm02_00330758 predicted 517
5 SASI_Mm02_00330759 predicted 315
6 SASI_Mm02_00330760 predicted 1140
7 SASI_Mm02_00330761 predicted 1204
8 SASI_Mm01_00026283 predicted 1219
9 SASI_Mm01_00026284 predicted 925
10 SASI_Mm02_00330762 predicted 641
11 SASI_Mm01_00026275 predicted 1202
12 SASI_Mm01_00026277 predicted 391
13 SASI_Mm01_00026278 predicted 534
14 SASI_Mm01_00026279 predicted 1616
15 SASI_Mm01_00026280 predicted 1189
16 SASI_Mm01_00026281 predicted 793
17 SASI_Mm01_00026282 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207354
VALIDATED
ANKRD13D MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13 family, member D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1308s1c1
Sequence:CCGGCCAGCAAAGTACAGAGGTTCACTCGAGTGAACCTCTGTACTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-575s1c1
Sequence:CCGGCCGGAACTGCTCAACAAACTTCTCGAGAAGTTTGTTGAGCAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-616s1c1
Sequence:CCGGCGTTGAGATGAAGTGGGAGTTCTCGAGAACTCCCACTTCATCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-956s1c1
Sequence:CCGGGACACTCGTAATGTGGCCTTTCTCGAGAAAGGCCACATTACGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1018s1c1
Sequence:CCGGGATGGAAACTGTTAGCGGCTACTCGAGTAGCCGCTAACAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-607s1c1
Sequence:CCGGCGATTTCTACGTTGAGATGAACTCGAGTTCATCTCAACGTAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-1011s1c1
Sequence:CCGGCTGAGAAGATGGAAACTGTTACTCGAGTAACAGTTTCCATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-571s1c1
Sequence:CCGGCATTCCGGAACTGCTCAACAACTCGAGTTGTTGAGCAGTTCCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1306s1c1
Sequence:CCGGGTCCAGCAAAGTACAGAGGTTCTCGAGAACCTCTGTACTTTGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1135s1c1
Sequence:CCGGGAAGACTCCATTCCAGTCCTTCTCGAGAAGGACTGGAATGGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207354
VALIDATED
ANKRD13D MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13 family, member D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1308s1c1
Sequence:CCGGCCAGCAAAGTACAGAGGTTCACTCGAGTGAACCTCTGTACTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-575s1c1
Sequence:CCGGCCGGAACTGCTCAACAAACTTCTCGAGAAGTTTGTTGAGCAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-616s1c1
Sequence:CCGGCGTTGAGATGAAGTGGGAGTTCTCGAGAACTCCCACTTCATCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-956s1c1
Sequence:CCGGGACACTCGTAATGTGGCCTTTCTCGAGAAAGGCCACATTACGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1018s1c1
Sequence:CCGGGATGGAAACTGTTAGCGGCTACTCGAGTAGCCGCTAACAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-607s1c1
Sequence:CCGGCGATTTCTACGTTGAGATGAACTCGAGTTCATCTCAACGTAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-1011s1c1
Sequence:CCGGCTGAGAAGATGGAAACTGTTACTCGAGTAACAGTTTCCATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-571s1c1
Sequence:CCGGCATTCCGGAACTGCTCAACAACTCGAGTTGTTGAGCAGTTCCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1306s1c1
Sequence:CCGGGTCCAGCAAAGTACAGAGGTTCTCGAGAACCTCTGTACTTTGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1135s1c1
Sequence:CCGGGAAGACTCCATTCCAGTCCTTCTCGAGAAGGACTGGAATGGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207354
VALIDATED
ANKRD13D MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13 family, member D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1308s1c1
Sequence:CCGGCCAGCAAAGTACAGAGGTTCACTCGAGTGAACCTCTGTACTTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-575s1c1
Sequence:CCGGCCGGAACTGCTCAACAAACTTCTCGAGAAGTTTGTTGAGCAGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-616s1c1
Sequence:CCGGCGTTGAGATGAAGTGGGAGTTCTCGAGAACTCCCACTTCATCTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-956s1c1
Sequence:CCGGGACACTCGTAATGTGGCCTTTCTCGAGAAAGGCCACATTACGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1018s1c1
Sequence:CCGGGATGGAAACTGTTAGCGGCTACTCGAGTAGCCGCTAACAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-607s1c1
Sequence:CCGGCGATTTCTACGTTGAGATGAACTCGAGTTCATCTCAACGTAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-1011s1c1
Sequence:CCGGCTGAGAAGATGGAAACTGTTACTCGAGTAACAGTTTCCATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_207354.1-571s1c1
Sequence:CCGGCATTCCGGAACTGCTCAACAACTCGAGTTGTTGAGCAGTTCCGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1306s1c1
Sequence:CCGGGTCCAGCAAAGTACAGAGGTTCTCGAGAACCTCTGTACTTTGCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207354.1-1135s1c1
Sequence:CCGGGAAGACTCCATTCCAGTCCTTCTCGAGAAGGACTGGAATGGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026720
ANKRD13D MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 13 family, member D
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1058s1c1
Sequence:CCGGCAGCTATCTCTGCTGAGGAATCTCGAGATTCCTCAGCAGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1293s1c1
Sequence:CCGGCTTCCCTGTCAAGATTGAGATCTCGAGATCTCAATCTTGACAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1095s1c1
Sequence:CCGGCAGCCTGGAATCCAGAAACATCTCGAGATGTTTCTGGATTCCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1930s21c1
Sequence:CCGGAGCAGGAAGAAGACGACTTACCTCGAGGTAAGTCGTCTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1319s21c1
Sequence:CCGGGGCCATCAGCAACGCTCATTTCTCGAGAAATGAGCGTTGCTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1291s21c1
Sequence:CCGGACCAGGTGACACCCATCATTGCTCGAGCAATGATGGGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-886s21c1
Sequence:CCGGTAGCCTTTGAGAGGAACAAATCTCGAGATTTGTTCCTCTCAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-335s21c1
Sequence:CCGGGAGAGTCCTCCTCCGACATAACTCGAGTTATGTCGGAGGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026720
ANKRD13D MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 13 family, member D
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1058s1c1
Sequence:CCGGCAGCTATCTCTGCTGAGGAATCTCGAGATTCCTCAGCAGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1293s1c1
Sequence:CCGGCTTCCCTGTCAAGATTGAGATCTCGAGATCTCAATCTTGACAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1095s1c1
Sequence:CCGGCAGCCTGGAATCCAGAAACATCTCGAGATGTTTCTGGATTCCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1930s21c1
Sequence:CCGGAGCAGGAAGAAGACGACTTACCTCGAGGTAAGTCGTCTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1319s21c1
Sequence:CCGGGGCCATCAGCAACGCTCATTTCTCGAGAAATGAGCGTTGCTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1291s21c1
Sequence:CCGGACCAGGTGACACCCATCATTGCTCGAGCAATGATGGGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-886s21c1
Sequence:CCGGTAGCCTTTGAGAGGAACAAATCTCGAGATTTGTTCCTCTCAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-335s21c1
Sequence:CCGGGAGAGTCCTCCTCCGACATAACTCGAGTTATGTCGGAGGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026720
ANKRD13D MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 13 family, member D
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1058s1c1
Sequence:CCGGCAGCTATCTCTGCTGAGGAATCTCGAGATTCCTCAGCAGAGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1293s1c1
Sequence:CCGGCTTCCCTGTCAAGATTGAGATCTCGAGATCTCAATCTTGACAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026720.1-1095s1c1
Sequence:CCGGCAGCCTGGAATCCAGAAACATCTCGAGATGTTTCTGGATTCCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1930s21c1
Sequence:CCGGAGCAGGAAGAAGACGACTTACCTCGAGGTAAGTCGTCTTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1319s21c1
Sequence:CCGGGGCCATCAGCAACGCTCATTTCTCGAGAAATGAGCGTTGCTGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-1291s21c1
Sequence:CCGGACCAGGTGACACCCATCATTGCTCGAGCAATGATGGGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-886s21c1
Sequence:CCGGTAGCCTTTGAGAGGAACAAATCTCGAGATTTGTTCCTCTCAAAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026720.2-335s21c1
Sequence:CCGGGAGAGTCCTCCTCCGACATAACTCGAGTTATGTCGGAGGAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks