EMAIL THIS PAGE TO A FRIEND

ANKRD16

ankyrin repeat domain 16

88 Gene Product Result for
UniProtKB ID: Q6P6B7, A6NEF0, F8WEI4, Q9NT01
Gene ID:
Mouse(320816) ankyrin repeat domain 16
Rat(307102) ankyrin repeat domain 16
Zebrafish(550225) ankyrin repeat domain 16
chicken(416688) ankyrin repeat domain 16
cow(784882) ankyrin repeat domain 16-like
cow(507779) ankyrin repeat domain 16
domestic cat(101081988) ankyrin repeat domain 16
dog(100684420) ankyrin repeat domain 16
sheep(101105093) ankyrin repeat domain 16
naked mole-rat(101726427) ankyrin repeat domain 16
domestic guinea pig(100715900) ankyrin repeat domain 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061561 MISSION® esiRNA esiRNA human ANKRD16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009941 Rosetta Predictions human pricing
NM_001009942 Rosetta Predictions human pricing
NM_001009943 Rosetta Predictions human pricing
NM_019046 Rosetta Predictions human pricing
NM_001033698 Rosetta Predictions rat pricing
NM_177268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108429 predicted 410
2 SASI_Hs01_00108430 predicted 344
3 SASI_Hs01_00108432 predicted 409
4 SASI_Hs01_00108433 predicted 408
5 SASI_Hs01_00108434 predicted 462
6 SASI_Hs01_00108435 predicted 494
7 SASI_Hs01_00108436 predicted 468
8 SASI_Hs01_00108437 predicted 404
9 SASI_Hs01_00108428 predicted 514
10 SASI_Hs01_00108431 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140992 predicted 405
2 SASI_Hs01_00140993 predicted 344
3 SASI_Hs01_00140995 predicted 409
4 SASI_Hs01_00140996 predicted 399
5 SASI_Hs01_00140997 predicted 471
6 SASI_Hs01_00140998 predicted 490
7 SASI_Hs01_00140999 predicted 471
8 SASI_Hs01_00141000 predicted 399
9 SASI_Hs01_00140991 predicted 511
10 SASI_Hs01_00140994 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014484 predicted 409
2 SASI_Hs01_00014485 predicted 344
3 SASI_Hs01_00014487 predicted 410
4 SASI_Hs01_00014488 predicted 407
5 SASI_Hs01_00014489 predicted 467
6 SASI_Hs01_00014490 predicted 490
7 SASI_Hs01_00014491 predicted 470
8 SASI_Hs01_00014492 predicted 406
9 SASI_Hs01_00014483 predicted 515
10 SASI_Hs01_00014486 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236887 predicted 401
2 SASI_Hs01_00236888 predicted 350
3 SASI_Hs01_00236890 predicted 407
4 SASI_Hs01_00236891 predicted 403
5 SASI_Hs01_00236892 predicted 471
6 SASI_Hs01_00236893 predicted 490
7 SASI_Hs01_00236894 predicted 469
8 SASI_Hs01_00236895 predicted 402
9 SASI_Hs01_00236886 predicted 511
10 SASI_Hs01_00236889 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049636 predicted 1068
2 SASI_Rn01_00049638 predicted 520
3 SASI_Rn01_00049639 predicted 266
4 SASI_Rn01_00049640 predicted 928
5 SASI_Rn01_00049641 predicted 698
6 SASI_Rn01_00049642 predicted 815
7 SASI_Rn02_00203729 predicted 793
8 SASI_Rn02_00203730 predicted 358
9 SASI_Rn01_00049644 predicted 653
10 SASI_Rn01_00049645 predicted 430
11 SASI_Rn01_00049637 predicted 895
12 SASI_Rn01_00049643 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347308 predicted 200
2 SASI_Mm02_00347309 predicted 196
3 SASI_Mm02_00347310 predicted 284
4 SASI_Mm02_00347311 predicted 325
5 SASI_Mm02_00347312 predicted 314
6 SASI_Mm01_00094872 predicted 345
7 SASI_Mm02_00347313 predicted 385
8 SASI_Mm02_00347314 predicted 325
9 SASI_Mm02_00347315 predicted 212
10 SASI_Mm02_00347316 predicted 419
11 SASI_Mm01_00094863 predicted 720
12 SASI_Mm01_00094864 predicted 850
13 SASI_Mm01_00094865 predicted 680
14 SASI_Mm01_00094866 predicted 1049
15 SASI_Mm01_00094867 predicted 592
16 SASI_Mm01_00094868 predicted 458
17 SASI_Mm01_00094869 predicted 880
18 SASI_Mm01_00094870 predicted 999
19 SASI_Mm01_00094871 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019046
VALIDATED
ANKRD16 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 16
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1098s21c1
Sequence:CCGGGGCAGTCAAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-852s21c1
Sequence:CCGGCGACTGGACTCCTCTGATGATCTCGAGATCATCAGAGGAGTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1169s21c1
Sequence:CCGGTGATGGACGCAATCCAGTGTGCTCGAGCACACTGGATTGCGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1331s21c1
Sequence:CCGGGCGTCGATGTAGATGTGAGAGCTCGAGCTCTCACATCTACATCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1396s21c1
Sequence:CCGGGGACATACAAGTACAATTCAGCTCGAGCTGAATTGTACTTGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019046.2-1887s21c1
Sequence:CCGGATGACATCACCAACCATTGACCTCGAGGTCAATGGTTGGTGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1582s21c1
Sequence:CCGGAGGAGAGCAGATGTCCTTCAGCTCGAGCTGAAGGACATCTGCTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1526s21c1
Sequence:CCGGAGTCGGGACTGAAGGATTCTGCTCGAGCAGAATCCTTCAGTCCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1125s21c1
Sequence:CCGGCCAATATGAACCAGACTACAGCTCGAGCTGTAGTCTGGTTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1609s21c1
Sequence:CCGGGGCCATAGCGCAATGACATAACTCGAGTTATGTCATTGCGCTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-1219s1c1
Sequence:CCGGCCTGAACCTGAGTTCAACCAACTCGAGTTGGTTGAACTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-791s1c1
Sequence:CCGGCATCCGATTCTTGGTCTCTGACTCGAGTCAGAGACCAAGAATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-425s1c1
Sequence:CCGGGAAGAACAAAGATGGCTGGAACTCGAGTTCCAGCCATCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019046.1-1262s1c1
Sequence:CCGGCCAGCGAGATCAAAGTTGTATCTCGAGATACAACTTTGATCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019046.1-871s1c1
Sequence:CCGGCAGCTAAGGAAGGACATACAACTCGAGTTGTATGTCCTTCCTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-848s1c1
Sequence:CCGGCCACCTCACAGCACTTCATTACTCGAGTAATGAAGTGCTGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019046
VALIDATED
ANKRD16 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 16
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1098s21c1
Sequence:CCGGGGCAGTCAAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-852s21c1
Sequence:CCGGCGACTGGACTCCTCTGATGATCTCGAGATCATCAGAGGAGTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1169s21c1
Sequence:CCGGTGATGGACGCAATCCAGTGTGCTCGAGCACACTGGATTGCGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1331s21c1
Sequence:CCGGGCGTCGATGTAGATGTGAGAGCTCGAGCTCTCACATCTACATCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1396s21c1
Sequence:CCGGGGACATACAAGTACAATTCAGCTCGAGCTGAATTGTACTTGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019046.2-1887s21c1
Sequence:CCGGATGACATCACCAACCATTGACCTCGAGGTCAATGGTTGGTGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1582s21c1
Sequence:CCGGAGGAGAGCAGATGTCCTTCAGCTCGAGCTGAAGGACATCTGCTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1526s21c1
Sequence:CCGGAGTCGGGACTGAAGGATTCTGCTCGAGCAGAATCCTTCAGTCCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1125s21c1
Sequence:CCGGCCAATATGAACCAGACTACAGCTCGAGCTGTAGTCTGGTTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1609s21c1
Sequence:CCGGGGCCATAGCGCAATGACATAACTCGAGTTATGTCATTGCGCTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-1219s1c1
Sequence:CCGGCCTGAACCTGAGTTCAACCAACTCGAGTTGGTTGAACTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-791s1c1
Sequence:CCGGCATCCGATTCTTGGTCTCTGACTCGAGTCAGAGACCAAGAATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-425s1c1
Sequence:CCGGGAAGAACAAAGATGGCTGGAACTCGAGTTCCAGCCATCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019046.1-1262s1c1
Sequence:CCGGCCAGCGAGATCAAAGTTGTATCTCGAGATACAACTTTGATCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019046.1-871s1c1
Sequence:CCGGCAGCTAAGGAAGGACATACAACTCGAGTTGTATGTCCTTCCTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-848s1c1
Sequence:CCGGCCACCTCACAGCACTTCATTACTCGAGTAATGAAGTGCTGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019046
VALIDATED
ANKRD16 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 16
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1098s21c1
Sequence:CCGGGGCAGTCAAGGTGCTTCTTAACTCGAGTTAAGAAGCACCTTGACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-852s21c1
Sequence:CCGGCGACTGGACTCCTCTGATGATCTCGAGATCATCAGAGGAGTCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1169s21c1
Sequence:CCGGTGATGGACGCAATCCAGTGTGCTCGAGCACACTGGATTGCGTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1331s21c1
Sequence:CCGGGCGTCGATGTAGATGTGAGAGCTCGAGCTCTCACATCTACATCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1396s21c1
Sequence:CCGGGGACATACAAGTACAATTCAGCTCGAGCTGAATTGTACTTGTATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019046.2-1887s21c1
Sequence:CCGGATGACATCACCAACCATTGACCTCGAGGTCAATGGTTGGTGATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1582s21c1
Sequence:CCGGAGGAGAGCAGATGTCCTTCAGCTCGAGCTGAAGGACATCTGCTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1526s21c1
Sequence:CCGGAGTCGGGACTGAAGGATTCTGCTCGAGCAGAATCCTTCAGTCCCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1125s21c1
Sequence:CCGGCCAATATGAACCAGACTACAGCTCGAGCTGTAGTCTGGTTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019046.2-1609s21c1
Sequence:CCGGGGCCATAGCGCAATGACATAACTCGAGTTATGTCATTGCGCTATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-1219s1c1
Sequence:CCGGCCTGAACCTGAGTTCAACCAACTCGAGTTGGTTGAACTCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_019046.1-791s1c1
Sequence:CCGGCATCCGATTCTTGGTCTCTGACTCGAGTCAGAGACCAAGAATCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-425s1c1
Sequence:CCGGGAAGAACAAAGATGGCTGGAACTCGAGTTCCAGCCATCTTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019046.1-1262s1c1
Sequence:CCGGCCAGCGAGATCAAAGTTGTATCTCGAGATACAACTTTGATCTCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019046.1-871s1c1
Sequence:CCGGCAGCTAAGGAAGGACATACAACTCGAGTTGTATGTCCTTCCTTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019046.1-848s1c1
Sequence:CCGGCCACCTCACAGCACTTCATTACTCGAGTAATGAAGTGCTGTGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177268
VALIDATED
ANKRD16 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1456s21c1
Sequence:CCGGCGCCCTTCATGGATGCAATTCCTCGAGGAATTGCATCCATGAAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1897s21c1
Sequence:CCGGACTTTGACCATGACGTGAAATCTCGAGATTTCACGTCATGGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-348s1c1
Sequence:CCGGCACAAGGAAGAACCTTGATGTCTCGAGACATCAAGGTTCTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-509s1c1
Sequence:CCGGCAGAGAGCAACATTAGAAGAACTCGAGTTCTTCTAATGTTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-364s1c1
Sequence:CCGGGATGTGATCCAGGACCTTGTACTCGAGTACAAGGTCCTGGATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-357s1c1
Sequence:CCGGGAACCTTGATGTGATCCAGGACTCGAGTCCTGGATCACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-400s1c1
Sequence:CCGGCCACTCCTGAAGAACAAGGATCTCGAGATCCTTGTTCTTCAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177268
VALIDATED
ANKRD16 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1456s21c1
Sequence:CCGGCGCCCTTCATGGATGCAATTCCTCGAGGAATTGCATCCATGAAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1897s21c1
Sequence:CCGGACTTTGACCATGACGTGAAATCTCGAGATTTCACGTCATGGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-348s1c1
Sequence:CCGGCACAAGGAAGAACCTTGATGTCTCGAGACATCAAGGTTCTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-509s1c1
Sequence:CCGGCAGAGAGCAACATTAGAAGAACTCGAGTTCTTCTAATGTTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-364s1c1
Sequence:CCGGGATGTGATCCAGGACCTTGTACTCGAGTACAAGGTCCTGGATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-357s1c1
Sequence:CCGGGAACCTTGATGTGATCCAGGACTCGAGTCCTGGATCACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-400s1c1
Sequence:CCGGCCACTCCTGAAGAACAAGGATCTCGAGATCCTTGTTCTTCAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177268
VALIDATED
ANKRD16 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1456s21c1
Sequence:CCGGCGCCCTTCATGGATGCAATTCCTCGAGGAATTGCATCCATGAAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177268.4-1897s21c1
Sequence:CCGGACTTTGACCATGACGTGAAATCTCGAGATTTCACGTCATGGTCAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-348s1c1
Sequence:CCGGCACAAGGAAGAACCTTGATGTCTCGAGACATCAAGGTTCTTCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-509s1c1
Sequence:CCGGCAGAGAGCAACATTAGAAGAACTCGAGTTCTTCTAATGTTGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-364s1c1
Sequence:CCGGGATGTGATCCAGGACCTTGTACTCGAGTACAAGGTCCTGGATCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177268.2-357s1c1
Sequence:CCGGGAACCTTGATGTGATCCAGGACTCGAGTCCTGGATCACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177268.2-400s1c1
Sequence:CCGGCCACTCCTGAAGAACAAGGATCTCGAGATCCTTGTTCTTCAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks