EMAIL THIS PAGE TO A FRIEND

ANKRD17

ankyrin repeat domain 17

155 Gene Product Result for
Synonyms: GTAR NY-BR-16
Gene ID:
Human(26057) Summary: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies in mice suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(81702) ankyrin repeat domain 17
Rat(289521) ankyrin repeat domain 17
domestic guinea pig(100727851) ankyrin repeat domain 17
naked mole-rat(101725960) ankyrin repeat domain 17
sheep(101103397) ankyrin repeat domain 17
Domestic Rabbit(100346384) ankyrin repeat domain 17
chicken(422651) ankyrin repeat domain 17
dog(475174) ankyrin repeat domain 17
domestic cat(101082309) ankyrin repeat domain 17
Horse(100055546) ankyrin repeat domain 17
cow(508405) ankyrin repeat domain 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074141 MISSION® esiRNA esiRNA human ANKRD17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032217 Rosetta Predictions human pricing
NM_198889 Rosetta Predictions human pricing
NM_001105999 Rosetta Predictions rat pricing
NM_030886 Rosetta Predictions mouse pricing
NM_198010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245742 predicted 5008
2 SASI_Hs01_00245743 predicted 1184
3 SASI_Hs01_00245744 predicted 3898
4 SASI_Hs01_00245745 predicted 3429
5 SASI_Hs02_00359513 predicted 4030
6 SASI_Hs01_00245746 predicted 6439
7 SASI_Hs02_00359514 predicted 7398
8 SASI_Hs01_00245747 predicted 1114
9 SASI_Hs01_00245748 predicted 5403
10 SASI_Hs01_00245751 predicted 3851
11 SASI_Hs01_00245749 predicted 5940
12 SASI_Hs01_00245750 predicted 7521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180105 predicted 4256
2 SASI_Hs01_00180106 predicted 1186
3 SASI_Hs01_00180107 predicted 3145
4 SASI_Hs01_00180108 predicted 2676
5 SASI_Hs02_00372392 predicted 3272
6 SASI_Hs01_00180109 predicted 5686
7 SASI_Hs02_00372393 predicted 6644
8 SASI_Hs01_00180110 predicted 1112
9 SASI_Hs01_00180111 predicted 4659
10 SASI_Hs01_00180114 predicted 3093
11 SASI_Hs01_00180112 predicted 5195
12 SASI_Hs01_00180113 predicted 6759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214632 predicted 4638
2 SASI_Rn02_00214633 predicted 6630
3 SASI_Rn02_00214634 predicted 7600
4 SASI_Rn02_00214635 predicted 4629
5 SASI_Rn02_00214636 predicted 3902
6 SASI_Rn02_00214637 predicted 2890
7 SASI_Rn02_00214638 predicted 5746
8 SASI_Rn02_00214639 predicted 7051
9 SASI_Rn02_00214640 predicted 2978
10 SASI_Rn02_00214641 predicted 4399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336960 predicted 1192
2 SASI_Mm01_00113021 predicted 7872
3 SASI_Mm02_00336961 predicted 4103
4 SASI_Mm01_00113022 predicted 7635
5 SASI_Mm02_00336962 predicted 713
6 SASI_Mm01_00113024 predicted 6900
7 SASI_Mm01_00113025 predicted 3911
8 SASI_Mm01_00113026 predicted 3858
9 SASI_Mm01_00113027 predicted 5414
10 SASI_Mm01_00113028 predicted 5474
11 SASI_Mm01_00113020 predicted 4216
12 SASI_Mm01_00113023 predicted 3445
13 SASI_Mm01_00113029 predicted 6067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350720 predicted 1189
2 SASI_Mm01_00119498 predicted 7119
3 SASI_Mm02_00350721 predicted 3348
4 SASI_Mm01_00119499 predicted 6886
5 SASI_Mm02_00350722 predicted 709
6 SASI_Mm01_00119501 predicted 6150
7 SASI_Mm01_00119502 predicted 3157
8 SASI_Mm01_00119503 predicted 3102
9 SASI_Mm01_00119504 predicted 4668
10 SASI_Mm01_00119505 predicted 4720
11 SASI_Mm01_00119497 predicted 3464
12 SASI_Mm01_00119500 predicted 2695
13 SASI_Mm01_00119506 predicted 5319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032217
VALIDATED
ANKRD17 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032217.3-6184s1c1
Sequence:CCGGGCACCCACAAATGCCACATATCTCGAGATATGTGGCATTTGTGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1790s1c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1189s1c1
Sequence:CCGGGCTAGTATTGAGGACCATAATCTCGAGATTATGGTCCTCAATACTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-4258s1c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-7207s1c1
Sequence:CCGGGCTGCTAACTTTAACAGACAACTCGAGTTGTCTGTTAAAGTTAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032217.3-1602s21c1
Sequence:CCGGGGTCAATGATGAAGGTTATACCTCGAGGTATAACCTTCATCATTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-4258s21c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-1790s21c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-2085s21c1
Sequence:CCGGGAATAGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-8243s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032217
VALIDATED
ANKRD17 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032217.3-6184s1c1
Sequence:CCGGGCACCCACAAATGCCACATATCTCGAGATATGTGGCATTTGTGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1790s1c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1189s1c1
Sequence:CCGGGCTAGTATTGAGGACCATAATCTCGAGATTATGGTCCTCAATACTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-4258s1c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-7207s1c1
Sequence:CCGGGCTGCTAACTTTAACAGACAACTCGAGTTGTCTGTTAAAGTTAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032217.3-1602s21c1
Sequence:CCGGGGTCAATGATGAAGGTTATACCTCGAGGTATAACCTTCATCATTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-4258s21c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-1790s21c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-2085s21c1
Sequence:CCGGGAATAGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-8243s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032217
VALIDATED
ANKRD17 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032217.3-6184s1c1
Sequence:CCGGGCACCCACAAATGCCACATATCTCGAGATATGTGGCATTTGTGGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1790s1c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-1189s1c1
Sequence:CCGGGCTAGTATTGAGGACCATAATCTCGAGATTATGGTCCTCAATACTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-4258s1c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032217.3-7207s1c1
Sequence:CCGGGCTGCTAACTTTAACAGACAACTCGAGTTGTCTGTTAAAGTTAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032217.3-1602s21c1
Sequence:CCGGGGTCAATGATGAAGGTTATACCTCGAGGTATAACCTTCATCATTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-4258s21c1
Sequence:CCGGGCAGCAGATAACCGCAAGATACTCGAGTATCTTGCGGTTATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-1790s21c1
Sequence:CCGGCCGATATAGAACTAGGGTGTTCTCGAGAACACCCTAGTTCTATATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-2085s21c1
Sequence:CCGGGAATAGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_032217.3-8243s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030886
VALIDATED
ANKRD17 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-1336s1c1
Sequence:CCGGGCCCTTACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-4105s1c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-7465s1c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030886.2-6373s1c1
Sequence:CCGGCCAGTAGTAGAACCTGCAAATCTCGAGATTTGCAGGTTCTACTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-5222s1c1
Sequence:CCGGCCTCTCCAAATGGGAAGTTAACTCGAGTTAACTTCCCATTTGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2094s21c1
Sequence:CCGGGAATCGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-7465s21c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-4105s21c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2190s21c1
Sequence:CCGGAGACCCTACTCACCGTTTAAACTCGAGTTTAAACGGTGAGTAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030886.2-8264s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030886
VALIDATED
ANKRD17 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-1336s1c1
Sequence:CCGGGCCCTTACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-4105s1c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-7465s1c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030886.2-6373s1c1
Sequence:CCGGCCAGTAGTAGAACCTGCAAATCTCGAGATTTGCAGGTTCTACTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-5222s1c1
Sequence:CCGGCCTCTCCAAATGGGAAGTTAACTCGAGTTAACTTCCCATTTGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2094s21c1
Sequence:CCGGGAATCGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-7465s21c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-4105s21c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2190s21c1
Sequence:CCGGAGACCCTACTCACCGTTTAAACTCGAGTTTAAACGGTGAGTAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030886.2-8264s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030886
VALIDATED
ANKRD17 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-1336s1c1
Sequence:CCGGGCCCTTACATTAGCTTGTTATCTCGAGATAACAAGCTAATGTAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-4105s1c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-7465s1c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030886.2-6373s1c1
Sequence:CCGGCCAGTAGTAGAACCTGCAAATCTCGAGATTTGCAGGTTCTACTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030886.2-5222s1c1
Sequence:CCGGCCTCTCCAAATGGGAAGTTAACTCGAGTTAACTTCCCATTTGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2094s21c1
Sequence:CCGGGAATCGAACCACAGCTAATAACTCGAGTTATTAGCTGTGGTTCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-7465s21c1
Sequence:CCGGCCATCTGTTATTGGGAGTAATCTCGAGATTACTCCCAATAACAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-4105s21c1
Sequence:CCGGGCCGCAGATAAAGGGCATTATCTCGAGATAATGCCCTTTATCTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030886.2-2190s21c1
Sequence:CCGGAGACCCTACTCACCGTTTAAACTCGAGTTTAAACGGTGAGTAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304678    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030886.2-8264s21c1
Sequence:CCGGTCTGAGCAAACACGGAAATTTCTCGAGAAATTTCCGTGTTTGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)