EMAIL THIS PAGE TO A FRIEND

ANKRD18A

ankyrin repeat domain 18A

44 Gene Product Result for
Species: Human ANKRD18A(253650)
UniProtKB ID: Q8IVF6, A7MD11, A8MVU5, Q5SY86, Q7Z468
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147195 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147195 Rosetta Predictions human pricing
XM_001713970 Rosetta Predictions human pricing
XM_001717620 Rosetta Predictions human pricing
XM_001726105 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142870 predicted 1099
2 SASI_Hs01_00142871 predicted 548
3 SASI_Hs01_00142872 predicted 1050
4 SASI_Hs01_00142873 predicted 1069
5 SASI_Hs01_00142874 predicted 778
6 SASI_Hs01_00142875 predicted 888
7 SASI_Hs01_00142876 predicted 849
8 SASI_Hs01_00142877 predicted 1115
9 SASI_Hs01_00142878 predicted 941
10 SASI_Hs01_00142879 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394155 predicted 3037
2 SASI_Hs02_00394156 predicted 3237
3 SASI_Hs02_00394157 predicted 3240
4 SASI_Hs02_00394158 predicted 2536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00418366 predicted 2987
2 SASI_Hs02_00418367 predicted 2985
3 SASI_Hs02_00418368 predicted 2277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00472003 predicted 3037
2 SASI_Hs02_00472004 predicted 3239
3 SASI_Hs02_00472005 predicted 3240
4 SASI_Hs02_00472006 predicted 2532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147195
VALIDATED
ANKRD18A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 18A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-197s1c1
Sequence:CCGGCGGAGAAACAGCGGATGAAATCTCGAGATTTCATCCGCTGTTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-329s1c1
Sequence:CCGGCTACTTCAAACCCACAGACTTCTCGAGAAGTCTGTGGGTTTGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-345s1c1
Sequence:CCGGGACTTCAAATAACTGCAAGAACTCGAGTTCTTGCAGTTATTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-88s1c1
Sequence:CCGGGAAGAATTTAAGGAAGCCTTTCTCGAGAAAGGCTTCCTTAAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-113s1c1
Sequence:CCGGGAGCAGTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_147195.1-250s1c1
Sequence:CCGGCCAGAGTTACCTTGTGTTGAACTCGAGTTCAACACAAGGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147195.1-1056s1c1
Sequence:CCGGGCACCTGTATCTGGATGTAATCTCGAGATTACATCCAGATACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147195
VALIDATED
ANKRD18A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 18A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-197s1c1
Sequence:CCGGCGGAGAAACAGCGGATGAAATCTCGAGATTTCATCCGCTGTTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-329s1c1
Sequence:CCGGCTACTTCAAACCCACAGACTTCTCGAGAAGTCTGTGGGTTTGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-345s1c1
Sequence:CCGGGACTTCAAATAACTGCAAGAACTCGAGTTCTTGCAGTTATTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-88s1c1
Sequence:CCGGGAAGAATTTAAGGAAGCCTTTCTCGAGAAAGGCTTCCTTAAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-113s1c1
Sequence:CCGGGAGCAGTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_147195.1-250s1c1
Sequence:CCGGCCAGAGTTACCTTGTGTTGAACTCGAGTTCAACACAAGGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147195.1-1056s1c1
Sequence:CCGGGCACCTGTATCTGGATGTAATCTCGAGATTACATCCAGATACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147195
VALIDATED
ANKRD18A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 18A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-197s1c1
Sequence:CCGGCGGAGAAACAGCGGATGAAATCTCGAGATTTCATCCGCTGTTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-329s1c1
Sequence:CCGGCTACTTCAAACCCACAGACTTCTCGAGAAGTCTGTGGGTTTGAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-345s1c1
Sequence:CCGGGACTTCAAATAACTGCAAGAACTCGAGTTCTTGCAGTTATTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-88s1c1
Sequence:CCGGGAAGAATTTAAGGAAGCCTTTCTCGAGAAAGGCTTCCTTAAATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147195.1-113s1c1
Sequence:CCGGGAGCAGTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_147195.1-250s1c1
Sequence:CCGGCCAGAGTTACCTTGTGTTGAACTCGAGTTCAACACAAGGTAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_147195.1-1056s1c1
Sequence:CCGGGCACCTGTATCTGGATGTAATCTCGAGATTACATCCAGATACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks