EMAIL THIS PAGE TO A FRIEND

ANKRD18B

ankyrin repeat domain 18B

24 Gene Product Result for
Synonyms: bA255A11.3 bA255A11.5
Species: Human ANKRD18B(441459)
UniProtKB ID: A2A2Z9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301287 ANTI-ANKRD18B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013728 Rosetta Predictions human pricing
XM_001716325 Rosetta Predictions human pricing
XM_001717197 Rosetta Predictions human pricing
XM_001718334 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021594 predicted 2346
2 SASI_Hs01_00021595 predicted 2617
3 SASI_Hs01_00021596 predicted 2091
4 SASI_Hs01_00021597 predicted 1907
5 SASI_Hs01_00021598 predicted 2815
6 SASI_Hs01_00021599 predicted 2175
7 SASI_Hs01_00021600 predicted 1640
8 SASI_Hs01_00021601 predicted 2003
9 SASI_Hs01_00021602 predicted 1607
10 SASI_Hs01_00021603 predicted 2421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00409795 predicted 3108
2 SASI_Hs02_00409796 predicted 3810
3 SASI_Hs02_00409797 predicted 3130
4 SASI_Hs02_00409798 predicted 3841
5 SASI_Hs02_00409799 predicted 3951
6 SASI_Hs02_00409800 predicted 3894
7 SASI_Hs02_00409801 predicted 3869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415631 predicted 3391
2 SASI_Hs02_00415632 predicted 3389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00423128 predicted 3857
2 SASI_Hs02_00423129 predicted 3957
3 SASI_Hs02_00423130 predicted 3909
4 SASI_Hs02_00423131 predicted 3877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013728
ANKRD18B MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 18B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-4132s1c1
Sequence:CCGGGCCTTGGGAAGTCATTCTCAACTCGAGTTGAGAATGACTTCCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2076s1c1
Sequence:CCGGGCTAAAGAAAGTCAATCCATTCTCGAGAATGGATTGACTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2361s1c1
Sequence:CCGGCAAGAAGAACTGGTCGATCATCTCGAGATGATCGACCAGTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3834s1c1
Sequence:CCGGGCTCTGCGTGAAGGATTGTTTCTCGAGAAACAATCCTTCACGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-1089s1c1
Sequence:CCGGGCAGCCATGAAGAATGAAAGTCTCGAGACTTTCATTCTTCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3889s1c1
Sequence:CCGGGCTCAGACTCAGCAATTCCATCTCGAGATGGAATTGCTGAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013728
ANKRD18B MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 18B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-4132s1c1
Sequence:CCGGGCCTTGGGAAGTCATTCTCAACTCGAGTTGAGAATGACTTCCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2076s1c1
Sequence:CCGGGCTAAAGAAAGTCAATCCATTCTCGAGAATGGATTGACTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2361s1c1
Sequence:CCGGCAAGAAGAACTGGTCGATCATCTCGAGATGATCGACCAGTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3834s1c1
Sequence:CCGGGCTCTGCGTGAAGGATTGTTTCTCGAGAAACAATCCTTCACGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-1089s1c1
Sequence:CCGGGCAGCCATGAAGAATGAAAGTCTCGAGACTTTCATTCTTCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3889s1c1
Sequence:CCGGGCTCAGACTCAGCAATTCCATCTCGAGATGGAATTGCTGAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013728
ANKRD18B MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 18B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-4132s1c1
Sequence:CCGGGCCTTGGGAAGTCATTCTCAACTCGAGTTGAGAATGACTTCCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2076s1c1
Sequence:CCGGGCTAAAGAAAGTCAATCCATTCTCGAGAATGGATTGACTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-2361s1c1
Sequence:CCGGCAAGAAGAACTGGTCGATCATCTCGAGATGATCGACCAGTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163336    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3834s1c1
Sequence:CCGGGCTCTGCGTGAAGGATTGTTTCTCGAGAAACAATCCTTCACGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013728.1-1089s1c1
Sequence:CCGGGCAGCCATGAAGAATGAAAGTCTCGAGACTTTCATTCTTCATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013728.1-3889s1c1
Sequence:CCGGGCTCAGACTCAGCAATTCCATCTCGAGATGGAATTGCTGAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks