EMAIL THIS PAGE TO A FRIEND

ANKRD18DP

ankyrin repeat domain 18D, pseudogene

22 Gene Product Result for
Species: Human ANKRD18DP(348840)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182631 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182631 Rosetta Predictions human pricing
NR_003291 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068275 predicted 936
2 SASI_Hs01_00068276 predicted 523
3 SASI_Hs01_00068277 predicted 939
4 SASI_Hs01_00068278 predicted 887
5 SASI_Hs01_00068279 predicted 616
6 SASI_Hs01_00068280 predicted 941
7 SASI_Hs01_00068281 predicted 898
8 SASI_Hs01_00068282 predicted 607
9 SASI_Hs01_00068283 predicted 476
10 SASI_Hs01_00068284 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379137 predicted 1131
2 SASI_Hs02_00379138 predicted 466
3 SASI_Hs02_00379139 predicted 2581
4 SASI_Hs02_00379140 predicted 1745
5 SASI_Hs02_00379141 predicted 1083
6 SASI_Hs02_00379142 predicted 552
7 SASI_Hs02_00379143 predicted 1135
8 SASI_Hs02_00379144 predicted 1094
9 SASI_Hs02_00379145 predicted 554
10 SASI_Hs02_00379146 predicted 2622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182631
ANKRD18DP MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 18D, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-476s1c1
Sequence:CCGGCAGATCGACATCTGTGACAGACTCGAGTCTGTCACAGATGTCGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-517s1c1
Sequence:CCGGGAAGGCTGTATATTGCCAGGACTCGAGTCCTGGCAATATACAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-493s1c1
Sequence:CCGGCAGACTAAACAGGACGCCTTTCTCGAGAAAGGCGTCCTGTTTAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-533s1c1
Sequence:CCGGCAGGAAGAGACGTGTTCCATTCTCGAGAATGGAACACGTCTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-508s1c1
Sequence:CCGGGCCTTTAATGAAGGCTGTATACTCGAGTATACAGCCTTCATTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182631
ANKRD18DP MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 18D, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-476s1c1
Sequence:CCGGCAGATCGACATCTGTGACAGACTCGAGTCTGTCACAGATGTCGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-517s1c1
Sequence:CCGGGAAGGCTGTATATTGCCAGGACTCGAGTCCTGGCAATATACAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-493s1c1
Sequence:CCGGCAGACTAAACAGGACGCCTTTCTCGAGAAAGGCGTCCTGTTTAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-533s1c1
Sequence:CCGGCAGGAAGAGACGTGTTCCATTCTCGAGAATGGAACACGTCTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-508s1c1
Sequence:CCGGGCCTTTAATGAAGGCTGTATACTCGAGTATACAGCCTTCATTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182631
ANKRD18DP MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 18D, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-476s1c1
Sequence:CCGGCAGATCGACATCTGTGACAGACTCGAGTCTGTCACAGATGTCGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-517s1c1
Sequence:CCGGGAAGGCTGTATATTGCCAGGACTCGAGTCCTGGCAATATACAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-493s1c1
Sequence:CCGGCAGACTAAACAGGACGCCTTTCTCGAGAAAGGCGTCCTGTTTAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-533s1c1
Sequence:CCGGCAGGAAGAGACGTGTTCCATTCTCGAGAATGGAACACGTCTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182631.1-508s1c1
Sequence:CCGGGCCTTTAATGAAGGCTGTATACTCGAGTATACAGCCTTCATTAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)