EMAIL THIS PAGE TO A FRIEND

ANKRD19P

ankyrin repeat domain 19, pseudogene

Synonyms: ANKRD19 bA526D8.2
Species: Human ANKRD19P(138649)
UniProtKB ID: Q9H560, A8K853, Q17RD3
Gene ID:
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010925 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010925 Rosetta Predictions human pricing
XR_040005 Rosetta Predictions human pricing
XR_040006 Rosetta Predictions human pricing
XR_040007 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223533 predicted 762
2 SASI_Hs01_00223534 predicted 872
3 SASI_Hs01_00223535 predicted 622
4 SASI_Hs01_00223536 predicted 337
5 SASI_Hs01_00223537 predicted 332
6 SASI_Hs01_00223538 predicted 875
7 SASI_Hs01_00223539 predicted 337
8 SASI_Hs01_00223540 predicted 590
9 SASI_Hs01_00223541 predicted 623
10 SASI_Hs01_00223542 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515071 predicted 1029
2 SASI_Hs02_00515072 predicted 741
3 SASI_Hs02_00515073 predicted 2242
4 SASI_Hs02_00515074 predicted 2253
5 SASI_Hs02_00515075 predicted 734
6 SASI_Hs02_00515076 predicted 741
7 SASI_Hs02_00515077 predicted 999
8 SASI_Hs02_00515078 predicted 1029
9 SASI_Hs02_00515079 predicted 816
10 SASI_Hs02_00515080 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515081 predicted 972
2 SASI_Hs02_00515082 predicted 681
3 SASI_Hs02_00515083 predicted 2188
4 SASI_Hs02_00515084 predicted 2188
5 SASI_Hs02_00515085 predicted 682
6 SASI_Hs02_00515086 predicted 685
7 SASI_Hs02_00515087 predicted 938
8 SASI_Hs02_00515088 predicted 978
9 SASI_Hs02_00515089 predicted 749
10 SASI_Hs02_00515090 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515091 predicted 1029
2 SASI_Hs02_00515092 predicted 742
3 SASI_Hs02_00515093 predicted 2248
4 SASI_Hs02_00515094 predicted 2249
5 SASI_Hs02_00515095 predicted 741
6 SASI_Hs02_00515096 predicted 741
7 SASI_Hs02_00515097 predicted 1007
8 SASI_Hs02_00515098 predicted 1029
9 SASI_Hs02_00515099 predicted 813
10 SASI_Hs02_00515100 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010925
ANKRD19P MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 19, pseudogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-318s1c1
Sequence:CCGGGAGCAGAAGATGCCAGATCAACTCGAGTTGATCTGGCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1845s1c1
Sequence:CCGGCGGGTTTATGTGAGGTATTTACTCGAGTAAATACCTCACATAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1651s1c1
Sequence:CCGGCCCATTTACTGTAGGTAGTATCTCGAGATACTACCTACAGTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-522s1c1
Sequence:CCGGCCATGCAAATATTGAAGCACTCTCGAGAGTGCTTCAATATTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1964s1c1
Sequence:CCGGCGGGTACAATAAGAAAGAGATCTCGAGATCTCTTTCTTATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-762s1c1
Sequence:CCGGCGAGGATTATGCTGTTTGTTACTCGAGTAACAAACAGCATAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-427s1c1
Sequence:CCGGGCCAATCCAAACATTAAGGATCTCGAGATCCTTAATGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-403s1c1
Sequence:CCGGGCCATTATTCTCCTGGAACATCTCGAGATGTTCCAGGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010925
ANKRD19P MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 19, pseudogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-318s1c1
Sequence:CCGGGAGCAGAAGATGCCAGATCAACTCGAGTTGATCTGGCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1845s1c1
Sequence:CCGGCGGGTTTATGTGAGGTATTTACTCGAGTAAATACCTCACATAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1651s1c1
Sequence:CCGGCCCATTTACTGTAGGTAGTATCTCGAGATACTACCTACAGTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-522s1c1
Sequence:CCGGCCATGCAAATATTGAAGCACTCTCGAGAGTGCTTCAATATTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1964s1c1
Sequence:CCGGCGGGTACAATAAGAAAGAGATCTCGAGATCTCTTTCTTATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-762s1c1
Sequence:CCGGCGAGGATTATGCTGTTTGTTACTCGAGTAACAAACAGCATAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-427s1c1
Sequence:CCGGGCCAATCCAAACATTAAGGATCTCGAGATCCTTAATGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-403s1c1
Sequence:CCGGGCCATTATTCTCCTGGAACATCTCGAGATGTTCCAGGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010925
ANKRD19P MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 19, pseudogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-318s1c1
Sequence:CCGGGAGCAGAAGATGCCAGATCAACTCGAGTTGATCTGGCATCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1845s1c1
Sequence:CCGGCGGGTTTATGTGAGGTATTTACTCGAGTAAATACCTCACATAAACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1651s1c1
Sequence:CCGGCCCATTTACTGTAGGTAGTATCTCGAGATACTACCTACAGTAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-522s1c1
Sequence:CCGGCCATGCAAATATTGAAGCACTCTCGAGAGTGCTTCAATATTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010925.1-1964s1c1
Sequence:CCGGCGGGTACAATAAGAAAGAGATCTCGAGATCTCTTTCTTATTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-762s1c1
Sequence:CCGGCGAGGATTATGCTGTTTGTTACTCGAGTAACAAACAGCATAATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010925.1-427s1c1
Sequence:CCGGGCCAATCCAAACATTAAGGATCTCGAGATCCTTAATGTTTGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010925.1-403s1c1
Sequence:CCGGGCCATTATTCTCCTGGAACATCTCGAGATGTTCCAGGAGAATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks