EMAIL THIS PAGE TO A FRIEND

ANKRD1

ankyrin repeat domain 1 (cardiac muscle)

59 Gene Product Result for
Synonyms: ALRP C-193 CARP CVARP MCARP bA320F15.2
UniProtKB ID: Q15327, Q96LE7
Gene ID:
Human(27063) Summary: The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]
Mouse(107765) ankyrin repeat domain 1 (cardiac muscle)
Rat(27064) ankyrin repeat domain 1
chicken(378926) ankyrin repeat domain 1 (cardiac muscle)
domestic cat(101083971) ankyrin repeat domain 1 (cardiac muscle)
Horse(100071482) ankyrin repeat domain 1 (cardiac muscle)
dog(477764) ankyrin repeat domain 1 (cardiac muscle)
cow(510376) ankyrin repeat domain 1 (cardiac muscle)
sheep(100820746) ankyrin repeat domain 1 (cardiac muscle)
Domestic Rabbit(100008719) ankyrin repeat domain 1 (cardiac muscle)
naked mole-rat(101720229) ankyrin repeat domain 1 (cardiac muscle)
domestic guinea pig(100733077) ankyrin repeat domain 1 (cardiac muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014391 Rosetta Predictions human pricing
NM_013220 Rosetta Predictions rat pricing
NM_013468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345572 predicted 671
2 SASI_Hs01_00239992 predicted 939
3 SASI_Hs02_00345573 predicted 723
4 SASI_Hs01_00239993 predicted 1222
5 SASI_Hs01_00239995 predicted 1031
6 SASI_Hs01_00239997 predicted 334
7 SASI_Hs01_00239998 predicted 630
8 SASI_Hs01_00239999 predicted 661
9 SASI_Hs01_00240000 predicted 1197
10 SASI_Hs01_00240001 predicted 742
11 SASI_Hs01_00239994 predicted 1133
12 SASI_Hs01_00239996 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035501 predicted 921
2 SASI_Rn01_00035502 predicted 669
3 SASI_Rn01_00035503 predicted 589
4 SASI_Rn01_00035504 predicted 943
5 SASI_Rn01_00035505 predicted 847
6 SASI_Rn01_00035506 predicted 1115
7 SASI_Rn01_00035507 predicted 660
8 SASI_Rn01_00035509 predicted 301
9 SASI_Rn01_00035510 predicted 1276
10 SASI_Rn02_00261084 predicted 448
11 SASI_Rn01_00035508 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184711 predicted 649
2 SASI_Mm01_00184712 predicted 544
3 SASI_Mm01_00184713 predicted 586
4 SASI_Mm01_00184714 predicted 1290
5 SASI_Mm01_00184716 predicted 1230
6 SASI_Mm02_00322083 predicted 1237
7 SASI_Mm01_00184717 predicted 1301
8 SASI_Mm01_00184718 predicted 984
9 SASI_Mm01_00184719 predicted 304
10 SASI_Mm01_00184720 predicted 846
11 SASI_Mm01_00184715 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014391
ANKRD1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 1 (cardiac muscle)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-1047s21c1
Sequence:CCGGATGATCCGACTCCTGATTATGCTCGAGCATAATCAGGAGTCGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-725s21c1
Sequence:CCGGAGCATGCTTGGAAGGACATTTCTCGAGAAATGTCCTTCCAAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014391.2-1075s1c1
Sequence:CCGGCGGATCTCAACATCAAGAACTCTCGAGAGTTCTTGATGTTGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-561s1c1
Sequence:CCGGCCAGTTGTAAAGGAACCAGAACTCGAGTTCTGGTTCCTTTACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-636s1c1
Sequence:CCGGGAGAATAAACTGCCAGTAGTACTCGAGTACTACTGGCAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-1134s1c1
Sequence:CCGGCAGAATGGAACCAAAGCAATACTCGAGTATTGCTTTGGTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-684s1c1
Sequence:CCGGCCAGATGTTTGTGATGAGTATCTCGAGATACTCATCACAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014391.2-1542s1c1
Sequence:CCGGGCAAAGTTCAAGTGCCTACTTCTCGAGAAGTAGGCACTTGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014391
ANKRD1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 1 (cardiac muscle)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-1047s21c1
Sequence:CCGGATGATCCGACTCCTGATTATGCTCGAGCATAATCAGGAGTCGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-725s21c1
Sequence:CCGGAGCATGCTTGGAAGGACATTTCTCGAGAAATGTCCTTCCAAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014391.2-1075s1c1
Sequence:CCGGCGGATCTCAACATCAAGAACTCTCGAGAGTTCTTGATGTTGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-561s1c1
Sequence:CCGGCCAGTTGTAAAGGAACCAGAACTCGAGTTCTGGTTCCTTTACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-636s1c1
Sequence:CCGGGAGAATAAACTGCCAGTAGTACTCGAGTACTACTGGCAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-1134s1c1
Sequence:CCGGCAGAATGGAACCAAAGCAATACTCGAGTATTGCTTTGGTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-684s1c1
Sequence:CCGGCCAGATGTTTGTGATGAGTATCTCGAGATACTCATCACAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014391.2-1542s1c1
Sequence:CCGGGCAAAGTTCAAGTGCCTACTTCTCGAGAAGTAGGCACTTGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014391
ANKRD1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 1 (cardiac muscle)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-1047s21c1
Sequence:CCGGATGATCCGACTCCTGATTATGCTCGAGCATAATCAGGAGTCGGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014391.2-725s21c1
Sequence:CCGGAGCATGCTTGGAAGGACATTTCTCGAGAAATGTCCTTCCAAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014391.2-1075s1c1
Sequence:CCGGCGGATCTCAACATCAAGAACTCTCGAGAGTTCTTGATGTTGAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-561s1c1
Sequence:CCGGCCAGTTGTAAAGGAACCAGAACTCGAGTTCTGGTTCCTTTACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-636s1c1
Sequence:CCGGGAGAATAAACTGCCAGTAGTACTCGAGTACTACTGGCAGTTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-1134s1c1
Sequence:CCGGCAGAATGGAACCAAAGCAATACTCGAGTATTGCTTTGGTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014391.2-684s1c1
Sequence:CCGGCCAGATGTTTGTGATGAGTATCTCGAGATACTCATCACAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014391.2-1542s1c1
Sequence:CCGGGCAAAGTTCAAGTGCCTACTTCTCGAGAAGTAGGCACTTGAACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013468
VALIDATED
ANKRD1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 1 (cardiac muscle)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-1155s21c1
Sequence:CCGGGCACTGGGTTGTAGGTGTTAACTCGAGTTAACACCTACAACCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013468.3-603s21c1
Sequence:GTACCGGATTCCGAGATATGCTTGAATCCTCGAGGATTCAAGCATATCTCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-502s21c1
Sequence:CCGGGACGTCTGCGATGAGTATAAACTCGAGTTTATACTCATCGCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-841s21c1
Sequence:CCGGGTGAGGCTGAACCGCTATAAGCTCGAGCTTATAGCGGTTCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-561s21c1
Sequence:CCGGGGCGATCGTGGAGAAGTTAATCTCGAGATTAACTTCTCCACGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013468.2-1534s1c1
Sequence:CCGGCCCACAGATTTGGTTCGGTTTCTCGAGAAACCGAACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-991s1c1
Sequence:CCGGGCCTACAAGAACTCTCGCATACTCGAGTATGCGAGAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013468.2-593s1c1
Sequence:CCGGCCCAGATTGAATTCCGAGATACTCGAGTATCTCGGAATTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-462s1c1
Sequence:CCGGGCCAGTTGTAGAGAAATTCCTCTCGAGAGGAATTTCTCTACAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-948s1c1
Sequence:CCGGGCAGAGTGGAACCAAAGCAATCTCGAGATTGCTTTGGTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013468
VALIDATED
ANKRD1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 1 (cardiac muscle)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-1155s21c1
Sequence:CCGGGCACTGGGTTGTAGGTGTTAACTCGAGTTAACACCTACAACCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013468.3-603s21c1
Sequence:GTACCGGATTCCGAGATATGCTTGAATCCTCGAGGATTCAAGCATATCTCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-502s21c1
Sequence:CCGGGACGTCTGCGATGAGTATAAACTCGAGTTTATACTCATCGCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-841s21c1
Sequence:CCGGGTGAGGCTGAACCGCTATAAGCTCGAGCTTATAGCGGTTCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-561s21c1
Sequence:CCGGGGCGATCGTGGAGAAGTTAATCTCGAGATTAACTTCTCCACGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013468.2-1534s1c1
Sequence:CCGGCCCACAGATTTGGTTCGGTTTCTCGAGAAACCGAACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-991s1c1
Sequence:CCGGGCCTACAAGAACTCTCGCATACTCGAGTATGCGAGAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013468.2-593s1c1
Sequence:CCGGCCCAGATTGAATTCCGAGATACTCGAGTATCTCGGAATTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-462s1c1
Sequence:CCGGGCCAGTTGTAGAGAAATTCCTCTCGAGAGGAATTTCTCTACAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-948s1c1
Sequence:CCGGGCAGAGTGGAACCAAAGCAATCTCGAGATTGCTTTGGTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013468
VALIDATED
ANKRD1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 1 (cardiac muscle)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-1155s21c1
Sequence:CCGGGCACTGGGTTGTAGGTGTTAACTCGAGTTAACACCTACAACCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013468.3-603s21c1
Sequence:GTACCGGATTCCGAGATATGCTTGAATCCTCGAGGATTCAAGCATATCTCGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-502s21c1
Sequence:CCGGGACGTCTGCGATGAGTATAAACTCGAGTTTATACTCATCGCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-841s21c1
Sequence:CCGGGTGAGGCTGAACCGCTATAAGCTCGAGCTTATAGCGGTTCAGCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013468.3-561s21c1
Sequence:CCGGGGCGATCGTGGAGAAGTTAATCTCGAGATTAACTTCTCCACGATCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013468.2-1534s1c1
Sequence:CCGGCCCACAGATTTGGTTCGGTTTCTCGAGAAACCGAACCAAATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-991s1c1
Sequence:CCGGGCCTACAAGAACTCTCGCATACTCGAGTATGCGAGAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013468.2-593s1c1
Sequence:CCGGCCCAGATTGAATTCCGAGATACTCGAGTATCTCGGAATTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-462s1c1
Sequence:CCGGGCCAGTTGTAGAGAAATTCCTCTCGAGAGGAATTTCTCTACAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013468.2-948s1c1
Sequence:CCGGGCAGAGTGGAACCAAAGCAATCTCGAGATTGCTTTGGTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks