EMAIL THIS PAGE TO A FRIEND

ANKRD20A19P

ankyrin repeat domain 20 family, member A19, pseudogene

40 Gene Product Result for
Species: Human ANKRD20A19P(400110)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207439 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207439 Rosetta Predictions human pricing
XM_001715330 Rosetta Predictions human pricing
XM_001716376 Rosetta Predictions human pricing
XM_001717332 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021280 predicted 3632
2 SASI_Hs01_00021281 predicted 3634
3 SASI_Hs01_00021282 predicted 3617
4 SASI_Hs01_00021283 predicted 3634
5 SASI_Hs01_00021284 predicted 2936
6 SASI_Hs01_00021285 predicted 3620
7 SASI_Hs01_00021286 predicted 2888
8 SASI_Hs01_00021287 predicted 3080
9 SASI_Hs01_00021288 predicted 3092
10 SASI_Hs01_00021289 predicted 2997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402961 predicted 443
2 SASI_Hs02_00402962 predicted 208
3 SASI_Hs02_00402963 predicted 429
4 SASI_Hs02_00402964 predicted 300
5 SASI_Hs02_00402965 predicted 471
6 SASI_Hs02_00402966 predicted 443
7 SASI_Hs02_00402967 predicted 444
8 SASI_Hs02_00402968 predicted 433
9 SASI_Hs02_00402969 predicted 638
10 SASI_Hs02_00402970 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00410154 predicted 445
2 SASI_Hs02_00410155 predicted 209
3 SASI_Hs02_00410156 predicted 433
4 SASI_Hs02_00410157 predicted 302
5 SASI_Hs02_00410158 predicted 477
6 SASI_Hs02_00410159 predicted 442
7 SASI_Hs02_00410160 predicted 447
8 SASI_Hs02_00410161 predicted 430
9 SASI_Hs02_00410162 predicted 638
10 SASI_Hs02_00410163 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416558 predicted 448
2 SASI_Hs02_00416559 predicted 203
3 SASI_Hs02_00416560 predicted 433
4 SASI_Hs02_00416561 predicted 306
5 SASI_Hs02_00416562 predicted 473
6 SASI_Hs02_00416563 predicted 442
7 SASI_Hs02_00416564 predicted 452
8 SASI_Hs02_00416565 predicted 435
9 SASI_Hs02_00416566 predicted 638
10 SASI_Hs02_00416567 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207439
ANKRD20A19P MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A19, pseudogene
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4752s1c1
Sequence:CCGGCCTGTCCAAATCTTTCCAATACTCGAGTATTGGAAAGATTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3636s1c1
Sequence:CCGGCCAAATTGACATCTGTGACAACTCGAGTTGTCACAGATGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3566s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3956s1c1
Sequence:CCGGCCTCTTCAGTTGCTGAGACTACTCGAGTAGTCTCAGCAACTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207439.2-3775s1c1
Sequence:CCGGGCTCTCCAGTATGCTGTGTATCTCGAGATACACAGCATACTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3363s1c1
Sequence:CCGGCACCACCACCAAGAAGTTCTTCTCGAGAAGAACTTCTTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3369s1c1
Sequence:CCGGCACCAAGAAGTTCTTCGGCTTCTCGAGAAGCCGAAGAACTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3559s1c1
Sequence:CCGGCAGCACAGAACTGCTCTACATCTCGAGATGTAGAGCAGTTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4585s1c1
Sequence:CCGGGCTGATAATTCGGCGATGCTTCTCGAGAAGCATCGCCGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207439.2-3561s1c1
Sequence:CCGGGCACAGAACTGCTCTACATTTCTCGAGAAATGTAGAGCAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207439
ANKRD20A19P MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A19, pseudogene
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4752s1c1
Sequence:CCGGCCTGTCCAAATCTTTCCAATACTCGAGTATTGGAAAGATTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3636s1c1
Sequence:CCGGCCAAATTGACATCTGTGACAACTCGAGTTGTCACAGATGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3566s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3956s1c1
Sequence:CCGGCCTCTTCAGTTGCTGAGACTACTCGAGTAGTCTCAGCAACTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207439.2-3775s1c1
Sequence:CCGGGCTCTCCAGTATGCTGTGTATCTCGAGATACACAGCATACTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3363s1c1
Sequence:CCGGCACCACCACCAAGAAGTTCTTCTCGAGAAGAACTTCTTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3369s1c1
Sequence:CCGGCACCAAGAAGTTCTTCGGCTTCTCGAGAAGCCGAAGAACTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3559s1c1
Sequence:CCGGCAGCACAGAACTGCTCTACATCTCGAGATGTAGAGCAGTTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4585s1c1
Sequence:CCGGGCTGATAATTCGGCGATGCTTCTCGAGAAGCATCGCCGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207439.2-3561s1c1
Sequence:CCGGGCACAGAACTGCTCTACATTTCTCGAGAAATGTAGAGCAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207439
ANKRD20A19P MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A19, pseudogene
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4752s1c1
Sequence:CCGGCCTGTCCAAATCTTTCCAATACTCGAGTATTGGAAAGATTTGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3636s1c1
Sequence:CCGGCCAAATTGACATCTGTGACAACTCGAGTTGTCACAGATGTCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3566s1c1
Sequence:CCGGGAACTGCTCTACATTTGGCCTCTCGAGAGGCCAAATGTAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-3956s1c1
Sequence:CCGGCCTCTTCAGTTGCTGAGACTACTCGAGTAGTCTCAGCAACTGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140248    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207439.2-3775s1c1
Sequence:CCGGGCTCTCCAGTATGCTGTGTATCTCGAGATACACAGCATACTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3363s1c1
Sequence:CCGGCACCACCACCAAGAAGTTCTTCTCGAGAAGAACTTCTTGGTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3369s1c1
Sequence:CCGGCACCAAGAAGTTCTTCGGCTTCTCGAGAAGCCGAAGAACTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207439.2-3559s1c1
Sequence:CCGGCAGCACAGAACTGCTCTACATCTCGAGATGTAGAGCAGTTCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207439.2-4585s1c1
Sequence:CCGGGCTGATAATTCGGCGATGCTTCTCGAGAAGCATCGCCGAATTATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207439.2-3561s1c1
Sequence:CCGGGCACAGAACTGCTCTACATTTCTCGAGAAATGTAGAGCAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks