EMAIL THIS PAGE TO A FRIEND

ANKRD20A1

ankyrin repeat domain 20 family, member A1

22 Gene Product Result for
Synonyms: ANKRD20A
Species: Human ANKRD20A1(84210)
UniProtKB ID: Q5TYW2, Q9H0H6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409885 Anti-ANKRD20A1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032250 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359556 predicted 729
2 SASI_Hs02_00359557 predicted 745
3 SASI_Hs01_00161786 predicted 779
4 SASI_Hs02_00359558 predicted 720
5 SASI_Hs02_00359559 predicted 937
6 SASI_Hs02_00359560 predicted 746
7 SASI_Hs01_00161779 predicted 903
8 SASI_Hs01_00161780 predicted 904
9 SASI_Hs01_00161781 predicted 901
10 SASI_Hs01_00161782 predicted 915
11 SASI_Hs01_00161783 predicted 898
12 SASI_Hs01_00161784 predicted 905
13 SASI_Hs01_00161785 predicted 899
14 SASI_Hs01_00161787 predicted 173
15 SASI_Hs01_00161788 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032250
ANKRD20A1 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2366s21c1
Sequence:CCGGCATCAGAAAGAGGATCATAAACTCGAGTTTATGATCCTCTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-1830s21c1
Sequence:CCGGGGTATCAACAAGAGCTTAATGCTCGAGCATTAAGCTCTTGTTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2400s21c1
Sequence:CCGGATATCCAAAGAGGCTTTATTGCTCGAGCAATAAAGCCTCTTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-812s21c1
Sequence:CCGGGATGCAGAAGATTATGCTATTCTCGAGAATAGCATAATCTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-682s1c1
Sequence:CCGGCAAGTTCACATGCCGTTGATACTCGAGTATCAACGGCATGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1261s1c1
Sequence:CCGGCACAGGTCAAAGAAGGAAATACTCGAGTATTTCCTTCTTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-387s1c1
Sequence:CCGGCAGATTGATGTCTGTGACAAACTCGAGTTTGTCACAGACATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-2259s1c1
Sequence:CCGGGCAGAAGCTAAAGTGAATAATCTCGAGATTATTCACTTTAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032250.1-2963s1c1
Sequence:CCGGGCCTCATTTCTAGGAAATAAACTCGAGTTTATTTCCTAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1347s1c1
Sequence:CCGGGCTGGCAGATTAACCCAACAACTCGAGTTGTTGGGTTAATCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-594s1c1
Sequence:CCGGGCACTGGACAAGGACAATAATCTCGAGATTATTGTCCTTGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032250
ANKRD20A1 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2366s21c1
Sequence:CCGGCATCAGAAAGAGGATCATAAACTCGAGTTTATGATCCTCTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-1830s21c1
Sequence:CCGGGGTATCAACAAGAGCTTAATGCTCGAGCATTAAGCTCTTGTTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2400s21c1
Sequence:CCGGATATCCAAAGAGGCTTTATTGCTCGAGCAATAAAGCCTCTTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-812s21c1
Sequence:CCGGGATGCAGAAGATTATGCTATTCTCGAGAATAGCATAATCTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-682s1c1
Sequence:CCGGCAAGTTCACATGCCGTTGATACTCGAGTATCAACGGCATGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1261s1c1
Sequence:CCGGCACAGGTCAAAGAAGGAAATACTCGAGTATTTCCTTCTTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-387s1c1
Sequence:CCGGCAGATTGATGTCTGTGACAAACTCGAGTTTGTCACAGACATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-2259s1c1
Sequence:CCGGGCAGAAGCTAAAGTGAATAATCTCGAGATTATTCACTTTAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032250.1-2963s1c1
Sequence:CCGGGCCTCATTTCTAGGAAATAAACTCGAGTTTATTTCCTAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1347s1c1
Sequence:CCGGGCTGGCAGATTAACCCAACAACTCGAGTTGTTGGGTTAATCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-594s1c1
Sequence:CCGGGCACTGGACAAGGACAATAATCTCGAGATTATTGTCCTTGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032250
ANKRD20A1 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2366s21c1
Sequence:CCGGCATCAGAAAGAGGATCATAAACTCGAGTTTATGATCCTCTTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-1830s21c1
Sequence:CCGGGGTATCAACAAGAGCTTAATGCTCGAGCATTAAGCTCTTGTTGATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-2400s21c1
Sequence:CCGGATATCCAAAGAGGCTTTATTGCTCGAGCAATAAAGCCTCTTTGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032250.3-812s21c1
Sequence:CCGGGATGCAGAAGATTATGCTATTCTCGAGAATAGCATAATCTTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-682s1c1
Sequence:CCGGCAAGTTCACATGCCGTTGATACTCGAGTATCAACGGCATGTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1261s1c1
Sequence:CCGGCACAGGTCAAAGAAGGAAATACTCGAGTATTTCCTTCTTTGACCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-387s1c1
Sequence:CCGGCAGATTGATGTCTGTGACAAACTCGAGTTTGTCACAGACATCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-2259s1c1
Sequence:CCGGGCAGAAGCTAAAGTGAATAATCTCGAGATTATTCACTTTAGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032250.1-2963s1c1
Sequence:CCGGGCCTCATTTCTAGGAAATAAACTCGAGTTTATTTCCTAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-1347s1c1
Sequence:CCGGGCTGGCAGATTAACCCAACAACTCGAGTTGTTGGGTTAATCTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032250.1-594s1c1
Sequence:CCGGGCACTGGACAAGGACAATAATCTCGAGATTATTGTCCTTGTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks