EMAIL THIS PAGE TO A FRIEND

ANKRD20A2

ankyrin repeat domain 20 family, member A2

15 Gene Product Result for
Species: Human ANKRD20A2(441430)
UniProtKB ID: Q5SQ80
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012421 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089814 predicted 2146
2 SASI_Hs01_00089816 predicted 734
3 SASI_Hs01_00089817 predicted 738
4 SASI_Hs01_00089818 predicted 777
5 SASI_Hs01_00089819 predicted 719
6 SASI_Hs02_00306141 predicted 936
7 SASI_Hs02_00306142 predicted 749
8 SASI_Hs01_00089810 predicted 2021
9 SASI_Hs01_00089811 predicted 1922
10 SASI_Hs01_00089813 predicted 2015
11 SASI_Hs01_00089812 predicted 2112
12 SASI_Hs01_00089815 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012421
ANKRD20A2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-384s1c1
Sequence:CCGGGCCAGATTGATGTCTGTGACACTCGAGTGTCACAGACATCAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1829s1c1
Sequence:CCGGCGGTATCAACAAGAGCTTAATCTCGAGATTAAGCTCTTGTTGATACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1259s1c1
Sequence:CCGGCCACAGGTCAAAGAAGGAAATCTCGAGATTTCCTTCTTTGACCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3109s1c1
Sequence:CCGGGCCACATGTTAAGACCATAATCTCGAGATTATGGTCTTAACATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-2944s1c1
Sequence:CCGGGCTTAGAAACATGCCTCATTTCTCGAGAAATGAGGCATGTTTCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3222s1c1
Sequence:CCGGCCCAGATGAATTGAAGTGTATCTCGAGATACACTTCAATTCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012421
ANKRD20A2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-384s1c1
Sequence:CCGGGCCAGATTGATGTCTGTGACACTCGAGTGTCACAGACATCAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1829s1c1
Sequence:CCGGCGGTATCAACAAGAGCTTAATCTCGAGATTAAGCTCTTGTTGATACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1259s1c1
Sequence:CCGGCCACAGGTCAAAGAAGGAAATCTCGAGATTTCCTTCTTTGACCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3109s1c1
Sequence:CCGGGCCACATGTTAAGACCATAATCTCGAGATTATGGTCTTAACATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-2944s1c1
Sequence:CCGGGCTTAGAAACATGCCTCATTTCTCGAGAAATGAGGCATGTTTCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3222s1c1
Sequence:CCGGCCCAGATGAATTGAAGTGTATCTCGAGATACACTTCAATTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012421
ANKRD20A2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-384s1c1
Sequence:CCGGGCCAGATTGATGTCTGTGACACTCGAGTGTCACAGACATCAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1829s1c1
Sequence:CCGGCGGTATCAACAAGAGCTTAATCTCGAGATTAAGCTCTTGTTGATACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012421.1-1259s1c1
Sequence:CCGGCCACAGGTCAAAGAAGGAAATCTCGAGATTTCCTTCTTTGACCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3109s1c1
Sequence:CCGGGCCACATGTTAAGACCATAATCTCGAGATTATGGTCTTAACATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-2944s1c1
Sequence:CCGGGCTTAGAAACATGCCTCATTTCTCGAGAAATGAGGCATGTTTCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012421.1-3222s1c1
Sequence:CCGGCCCAGATGAATTGAAGTGTATCTCGAGATACACTTCAATTCATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012421.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)